Cours de Python gratuit

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

Bienvenue au cours de Python !

Cours de Python

Ce cours de Python a été conçu à l’origine pour les étudiants débutants en programmation Python des filières biologie et biochimie de l’Université Paris Diderot – Paris 7 ; et plus spécialement pour les étudiants du master Biologie Informatique.

Ce cours est basé sur les versions 2.x de Python et ne prend pas en compte, pour l’instant, les nouvelles versions 3.x. Néanmoins, nous essaierons de le mettre rapidement à jour de manière à traiter la compatibilité entre les deux générations. Si vous relevez des erreurs à la lecture de ce document, merci de nous les signaler.

Le cours est disponible en version HTML et PDF.

Remerciements

Un grand merci à Sander du CMBI de Nijmegen pour la première version de ce cours. Merci également à tous les contributeurs, occasionels ou réguliers : Jennifer Becq, Virginie

Martiny, Romain Laurent, Benoist Laurent, Benjamin Boyer, Hubert Santuz, Catherine Lesourd, Philippe Label, Rémi Cuchillo, Cédric Gageat, Philibert Malbranche, Mikaël Naveau. Nous re- mercions aussi Denis Mestivier de qui nous nous sommes inspirés pour certains exercices.

Enfin, merci à vous tous, les curieux de Python, qui avez été nombreux à nous envoyer des retours sur ce cours, à nous suggérer des corrections et à nous signaler des coquilles.

De nombreuses personnes nous ont aussi demandé les corrections des exercices. Nous ne les mettons pas sur le site afin d’éviter la tentation de les regarder trop vite, mais vous pouvez nous écrire et nous vous les enverrons.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

Table des matières

1 Introduction

1.1 Avant de commencer

1.2 Premier contact avec Python sous Linux

1.3 Premier programme Python

1.4 Commentaires

1.5 Séparateur d’instructions 

1.6 Notion de bloc d’instructions et d’indentation

2 Variables

2.1 Types

2.2 Nommage

2.3 Opérations

3 Écriture

3.1 Écriture formatée

3.2 Exercices

4 Listes

4.1 Définition

4.2 Utilisation

4.3 Opération sur les listes

4.4 Indiçage négatif et tranches

4.5 Fonctions range et len

4.6 Listes de listes

4.7 Exercices

5 Boucles et comparaisons

5.1 Boucles for

5.2 Comparaisons

5.3 Boucles while .

5.4 Exercices

6 Tests

6.1 Définition

6.2 Tests à plusieurs cas

6.3 Tests multiples

6.4 Instructions break et continue

6.5 Exercices

7 Fichiers

7.1 Lecture dans un fichier

7.2 Écriture dans un fichier 

7.3 Exercices

8Modules

8.1 Définition

8.2 Importation de modules

8.3 Obtenir de l’aide sur les modules importés

8.4 Modules courants

8.5 Module sys : passage d’arguments

8.6 Module os

8.7 Exercices

9 Plus sur les chaînes de caractères

9.1 Préambule

9.2 Chaînes de caractères et listes

9.3 Caractères spéciaux

9.4 Méthodes associées aux chaînes de caractères

9.5 Conversion de types

9.6 Conversion d’une liste de chaînes de caractères en une chaîne de caractères

9.7 Exercices

10 Plus sur les listes

10.1 Propriétés des listes

10.2 Test d’appartenance

10.3 Copie de listes

10.4 Exercices

11 Dictionnaires et tuples

11.1 Dictionnaires 

11.2 Tuples 

11.3 Exercices

12 Fonctions

12.1 Principe

12.2 Définition

12.3 Passage d’arguments

12.4 Portée des variables

12.5 Portée des listes

12.6 Règle LGI

12.7 Exercices

13 Expressions régulières et parsing

13.1 Définition et syntaxe

13.2 Module re et fonction search

13.3 Exercices : extraction des gènes d’un fichier genbank 

14 Création de modules

14.1 Création

14.2 Utilisation

14.3 Exercices

15 Autres modules d’intérêt

15.1 Module urllib2 

15.2 Module pickle

15.2.1 Codage des données

15.2.2 Décodage des données

15.3 Exercices

16 Modules d’intérêt en bioinformatique

16.1 Module numpy

16.1.1 Objets de type array

16.1.2 Un peu d’algèbre linéaire

16.1.3 Un peu de transformée de Fourier

16.2 Module biopython

16.3 Module matplotlib

16.4 Module rpy

16.5 Exercice numpy

16.6 Exercice rpy

17 Avoir la classe avec les objets

17.1 Exercices

18 Gestion des erreurs

19 Trucs et astuces

19.1 Shebang et /usr/bin/env python .

19.2 Python et utf-8

19.3 Vitesse d’itération dans les boucles

19.4 Liste de compréhension

19.5 Sauvegardez votre historique de commandes

1 Introduction

  1. Introduction
    1. Avant de commencer

Avant de débuter ce cours, voici quelques indications générales qui pourront vous servir pour la suite.

Familiarisez-vous avec le site www.python.org. Il contient énormément d’informations et de liens sur Python et vous permet en outre de le télécharger pour différentes plateformes (Linux, Mac, Windows). La page d’index des modules est particulièrement utile.

Pour aller plus loin avec Python, Gérard Swinnen a écrit un très bon livre intitulé Ap- prendre à programmer avec Python et téléchargeable gratuitement. Les éditions Eyrolles proposent également la version papier de cet ouvrage.

Ce cours est basé sur une utilisation de Python sous Linux mais il est parfaitement trans- posable aux systèmes d’exploitation Windows et Mac.

L’apprentissage d’un langage informatique comme Python va nécessiter d’écrire des lignes de codes à l’aide d’un éditeur de texte. Si vous êtes débutants, nous vous conseillons vive- ment d’utiliser gedit ou nedit, qui sont les plus proches des éditeurs que l’on peut trouver sous Windows (notepad). Des éditeurs comme emacs et vi sont très puissants mais néces- sitent un apprentissage particulier.

1.2 Premier contact avec Python sous Linux

Python est un langage interprété, c’est-à-dire que chaque ligne de code est lue puis inter- prétée afin d’être exécutée par l’ordinateur. Pour vous en rendre compte, lancez la commande :

python

Celle-ci va démarrer l’interpréteur Python. Vous devriez obtenir quelque chose de ce style :

[fuchs@opera ~]$ python

Python 2.5.1 (r251:54863, Jul 10 2008, 17:25:56)

[GCC 4.1.2 20070925 (Red Hat 4.1.2-33)] on linux2

Type « help », « copyright », « credits » or « license » for more information.

>>>

Le bloc [fuchs@opera ~]$ représente l’invite de commande de votre shell sous Linux.

Le triple chevron >>> est l’invite de Python (prompt en anglais), ce qui signifie que Python attend une commande. Tapez par exemple l’instruction

print « Hello world ! »

puis validez votre commande avec la touche Entrée.

Python a exécuté la commande directement et a affiché le texte Hello world !. Il attend ensuite votre prochaine instruction en affichant l’invite de l’interpréteur Python (>>> ). En ré- sumé, voici ce qui a du apparaître sur votre écran :

>>> print « Hello world ! » Hello world !

>>>

Vous pouvez refaire un nouvel essai en vous servant cette fois de l’interpréteur comme d’une machine à calculer.

6

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

1.3 Premier programme Python

1 Introduction

>>> 1 + 1

2

>>>

À ce stade, vous pouvez entrer une autre commande ou bien quitter l’interpréteur à l’aide des touches Ctrl-D. Finalement l’interpréteur Python est un système interactif dans lequel vous pouvez entrer des commandes, que Python exécutera sous vos yeux (au moment où vous vali- derez la commande en tapant sur Entrée).

Il existe de nombreux autres langages interprétés tels que Perl ou R. Le gros avantage est que l’on peut directement tester une commande à l’aide de l’interpréteur, ce qui est très utile pour débugger (c’est-à-dire corriger les éventuelles erreurs d’un programme). Gardez bien en mémoire cette propriété de Python qui pourra parfois vous faire gagner un temps précieux !

1.3 Premier programme Python

Bien sûr, l’interpréteur présente vite des limites dès lors que l’on veut exécuter une suite d’instructions plus complexe. Comme tout langage informatique, on peut enregistrer ces ins- tructions dans un fichier, que l’on appelle communément un script Python.

Pour reprendre l’exemple précédent, ouvrez un éditeur de texte (par exemple gedit ou nedit) et entrez le code suivant.

print ‘Hello World !’

Ensuite enregistrez votre fichier sous le nom test.py, puis quittez l’éditeur de texte. L’exten- sion standard des scripts Python est .py. Pour exécuter votre script, vous avez deux moyens.

1.Soit donner le nom de votre script comme argument à la commande Python :

[fuchs@opera ~]$ python test.py Hello World !

[fuchs@opera ~]$

2. Soit rendre votre fichier exécutable. Pour cela deux opérations sont nécessaires :

– Précisez au shell la localisation de l’interpréteur Python en indiquant dans la première ligne du script :

#!/usr/bin/env python

Dans notre exemple, le script test.py contient alors le texte suivant :

#!/usr/bin/env python

print ‘Hello World !’

– Rendez votre script Python exécutable en tapant :

chmod +x test.py

Pour exécuter votre script, tapez son nom précédé des deux caractères ./ (afin de préciser au shell où se trouve votre script) :

[fuchs@opera ~]$ ./test.py Hello World ! [fuchs@opera ~]$

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

7

1 Introduction

1.4 Commentaires

1.4 Commentaires

Dans un script, tout ce qui suit le caractère # est ignoré par Python jusqu’à la fin de la ligne et est considéré comme un commentaire. Une exception notable est la première ligne de votre script qui peut être #!/usr/bin/env python et qui a alors une signification particulière pour Python.

Les commentaires sont indispensables pour que vous puissiez annoter votre code. Il faut absolument les utiliser pour décrire les principales parties de votre code dans un langage hu- main.

#!/usr/bin/env python

# votre premier script Python print ‘Hello World !’

# d’autres commandes plus utiles pourraient suivre

1.5 Séparateur d’instructions

Python utilise l’espace comme séparateur d’instructions. Cela peut sembler évident, mais il est tout de même important de le préciser. Par exemple :

>>> print 1

1

>>> print1

Traceback (most recent call last): File « <stdin> », line 1, in <module>

NameError: name ‘print1’ is not defined

Omettre l’espace entre l’instruction print et le chiffre 1 renvoie une erreur.

1.6 Notion de bloc d’instructions et d’indentation

Pour terminer ce chapitre d’introduction, nous allons aborder dès maintenant les notions de bloc d’instructions et d’indentation.

En programmation, il est courant de répéter un certain nombre de choses (avec les boucles, voir chapitre 5) ou de faire des choix (avec les tests, voir chapitre 6).

Par exemple, imaginez que vous souhaitiez répéter 10 fois 3 instructions différentes, les unes à la suite des autres. Regardez l’exemple suivant en pseudo-code :

instruction_qui_indique_à_Python_de_répéter_10_fois_ce_qui_suit: sous-instruction1

sous-instruction2 sous-instruction3

instruction_suivante

La première ligne correspond à une instruction qui va indiquer à Python de répéter 10 fois d’autres instructions (il s’agit d’une boucle, on verra le nom de la commande exacte plus tard). Dans le pseudo-code ci-dessus, il y a 3 instructions à répéter, nommées sous-instruction1 à sous-instruction3.

Notez bien les détails de la syntaxe. La première ligne indique que l’on veut répéter une ou plusieurs instructions, elle se termine par :. Ce symbole : indique à Python qu’il doit attendre un bloc d’instructions, c’est-à-dire un certains nombres de sous-instructions à répéter. Python

8

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

1.6 Notion de bloc d’instructions et d’indentation

1 Introduction

reconnaît un bloc d’instructions car il est indenté. L’indentation est le décalage d’un ou plu- sieurs espaces ou tabulations des instructions sous-instruction1 à sous-instruction3, par rapport à instruction_qui_indique_à_Python_de_répéter_10_fois_ce_qui_suit:.

Pratiquement, l’indentation en Python doit être homogène (soit des espaces, soit des tabula- tions, mais pas un mélange des deux). Une indentation avec 4 espaces est le style d’indentation le plus traditionnel et celui qui permet une bonne lisibilité du code.

Enfin, la ligne instruction_suivante sera exécutée une fois que le bloc d’instructions sera terminé.

Si tout cela vous semble un peu fastidieux, ne vous inquiétez pas. Vous allez comprendre tous ces détails, et surtout les acquérir, en continuant ce cours chapitre par chapitre.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

9

2 Variables

2 Variables

Une variable est une zone de la mémoire dans laquelle une valeur est stockée. Aux yeux du programmeur, cette variable est définie par un nom, alors que pour l’ordinateur, il s’agit en fait d’une adresse (i.e. une zone particulière de la mémoire).

En Python, la déclaration d’une variable et son initialisation (c.-à-d. la première valeur que l’on va stocker dedans) se fait en même temps. Pour vous en convaincre, regardez puis testez les instructions suivantes après avoir lancé l’interpréteur :

>>> x = 2

>>> x 2

Dans cet exemple, nous avons déclaré, puis initialisé la variable x avec la valeur 2. L’inter- préteur nous a ensuite permis de regarder le contenu de la variable juste en tapant son nom. Retenez ceci car c’est une spécificité de l’interpréteur Python, très pratique pour chasser les erreurs (debug) dans un programme. Par contre, la ligne d’un script Python qui contient seule- ment le nom d’une variable (sans aucune autre fonction) n’affichera pas la valeur de la variable à l’écran.

2.1 Types

Le type d’une variable correspond à la nature de celle-ci. Les trois types principaux dont nous aurons besoin sont les entiers, les réels et les chaînes de caractères. Bien sûr, il existe de nombreux autres types (par exemple, les nombres complexes), c’est d’ailleurs un des gros avantages de Python (si vous n’êtes pas effrayés, vous pouvez vous en rendre compte ici).

Dans l’exemple précédent, nous avons stocké un nombre entier (int) dans la variable x, mais il est tout a fait possible de stocker des nombres réels (float) ou des chaînes de caractères (string) :

>>> y = 3.14

>>> y 3.1400000000000001

>>> a = « bonjour »

>>> a

‘bonjour’

>>> b = ‘salut’

>>> b

‘salut’

>>> c =  »’girafe »’

>>> c

‘girafe’

Vous remarquez que Python reconnaît certains types de variable automatiquement (en- tier, réel). Par contre, pour une chaîne de caractères, il faut l’entourer de guillemets (simples, doubles voire triples) afin d’indiquer à Python le début et la fin de la chaîne.

Vous vous posez sans doute une question concernant l’exemple du réel. Si vous avez entré le

chiffre 3.14, pourquoi Python l’imprime-t-il finalement avec des zéros derrière (3.1400000000000001) ? Un autre exemple :

>>> 1.9

1.8999999999999999

>>>

10

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

2.2 Nommage

2 Variables

Cette fois-ci, Python écrit 1.9 sous la forme 1.8 suivi de plusieurs 9 ! Cela s’explique par le fait que, sans rentrer dans les détails techniques, la manière de coder un réel dans l’ordinateur est rarement exacte. Python ne nous le cache pas et le montre lorsqu’il affiche ce nombre.

2.2 Nommage

Le nom des variable en Python peut-être constitué de lettres minuscules (a à z), de lettres majuscules (A à Z), de nombres (0 à 9) ou du caractère souligné (_).

Néanmoins, un nom de variable ne doit pas débuter ni par un chiffre, ni par _ et ne peut pas contenir de caractère accentué. Il faut absolument éviter d’utiliser un mot « réservé » par Python comme nom de variable (par ex. : print, range, for, from, etc.).

Python est sensible à la casse, ce qui signifie que les variables TesT, test ou TEST sont différentes. Enfin, n’utilisez jamais d’espace dans un nom de variable puisque celui-ci est le sépérateur d’instructions.

2.3 Opérations

Les quatre opérations de base se font de manière simple sur les types numériques (nombres entiers et réels) :

>>>

>>> 47

>>>

>>>

x x

=

+

45

2

y x

=

+

2.5

y

47.5

>>> (x 180.0

10) / y

*

Remarquez toutefois que si vous mélangez les types entiers et réels, le résultat est renvoyé comme un réel (car ce type est plus général).

L’opérateur puissance utilise le symbole ** et pour obtenir le reste d’une division entière, on utilise le symbole modulo % :

>>> 8

>>> 3

>>> 0

2**3

3 % 4

8 % 4

Opérations sur les chaînes de caractères

Pour les chaînes de caractères, deux opérations sont possibles, l’addition et la multiplica- tion :

>>> chaine = « Salut »

>>> chaine ‘Salut’

>>> chaine +  » Python » ‘Salut Python’

>>> chaine 3

* ‘SalutSalutSalut’

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

11

2 Variables

2.3 Opérations

L’opérateur d’addition + permet de concaténer (assembler) deux chaînes de caractères et l’opérateur de multiplication * permet de dupliquer plusieurs fois une chaîne.

Opérations illicites

Attention à ne pas faire d’opération illicite car vous obtiendriez un message d’erreur :

>>> ‘toto’ + 2

Traceback (most recent call last): File « <stdin> », line 1, in ?

TypeError: cannot concatenate ‘str’ and ‘int’ objects

Notez que Python vous donne le maximum d’indices dans son message d’erreur. Dans l’exemple précédent, il vous indique que vous ne pouvez pas mélanger des objets de type str (string, donc des chaînes de caractères) avec des objets de type int (donc des entiers), ce qui est assez logique.

Fonction type()

Si vous ne vous souvenez plus du type d’une variable, utilisez la fonction type qui vous le rappelle.

>>> x = 2

>>> type(x)

<type ‘int’>

>>> x = 2.0

>>> type(x)

<type ‘float’>

>>> x = ‘2’

>>> type(x)

<type ‘str’>

Faites bien attention, pour Python, la valeur 2 (nombre entier) est différente de 2.0 (nombre réel), de même que 2 (nombre entier) est différent de ‘2’ (chaîne de caractères).

12

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

3 Écriture

3 Écriture

Nous avons déjà vu au chapitre précédent la fonction print qui permet d’afficher une chaîne de caractères. Elle permet en plus d’afficher le contenu d’une ou plusieurs variables :

>>>

>>>

>>>

x = 32

nom = ‘John’

print nom , ‘ a ‘ , x , ‘ ans’

John

a

32

ans

Python a donc écrit la phrase en remplaçant les variables x et nom par leur contenu. Vous pouvez noter également que pour écrire plusieurs blocs de texte sur une seule ligne, nous avons utilisé le séparateur , avec la commande print. En regardant de plus près, vous vous aperçe- vrez que Python a automatiquement ajouté un espace à chaque fois que l’on utilisait le sépara- teur ,. Par conséquent, si vous voulez mettre un seul espace entre chaque bloc, vous pouvez retirer ceux de vos chaînes de caractères :

>>> print nom , ‘a’ , x , ‘ans’ John a 32 ans

Pour imprimer deux chaînes de caractères l’une à côté de l’autre sans espace, vous devrez les concaténer :

>>>

>>>

>>>

ani1 = ‘chat’ ani2 = ‘souris’ print ani1, ani2

chat souris

>>> print ani1 + ani2 chatsouris

3.1 Écriture formatée

Imaginez que vous vouliez calculer puis afficher la proportion de GC d’un génome. Notez que la proportion de GC s’obtient comme la somme des bases Guanine (G) et Cytosine (C) divisée par le nombre total de bases. Sachant que l’on a 4500 bases G, 2575 bases C pour un total de 14800 bases, vous pourriez faire comme suit (notez bien l’utilisation des parenthèses pour gérer les priorités des opérateurs) :

>>> propGC = (4500.0 + 2575)/14800

>>> print « La proportion de GC est », propGC La proportion de GC est 0.478040540541

Remarquez que si vous aviez fait le calcul avec (4500 + 2575)/14800, vous auriez ob- tenu 0 car tous les nombres sont des entiers et le résultat aurait été, lui aussi, un entier. L’intro- duction de 4500.0 qui est un réel résoud le problème, puisque le calcul se fait alors sur des réels.

Néanmoins, le résultat obtenu présente trop de décimales (onze dans le cas présent). Pour pouvoir écrire le résultat plus lisiblement, vous pouvez utiliser l’opérateur de formatage %. Dans votre cas, vous voulez formater un réel pour l’afficher avec deux puis trois décimales :

>>> print « La Le proportion

>>> print « La La proportion

proportion de GC est %.2f » % propGC de GC est 0.48

proportion de GC est %.3f » % propGC de GC est 0.478

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

13

3 Écriture

3.1 Écriture formatée

Le signe % est appelé une première fois (%.2f) pour

1.

2.

3.

désigner l’endroit où sera placée la variable dans la chaîne de caractères ;

préciser le type de la variable à formater, ici f pour float donc pour un réel ; préciser le formatage voulu, ici .2 soit deux chiffres après la virgule.

Le signe % est rappelé une seconde fois (% propGC) pour indiquer les variables à formater. Notez que les réels ainsi formatés sont arrondis et non tronqués.

Vous pouvez aussi formatez des entiers avec %i (i comme integer)

>>> nbG =

>>> print Le génome

4500

« Le génome de cet exemple contient %i guanines » % nbG de cet exemple contient 4500 guanines

ou mettre plusieurs nombres dans une même chaîne de caractères.

>>>

>>>

>>>

nbG = nbC = print

4500

2575

« Ce génome contient %i G et %i C, soit une prop de GC de %.2f »

\

% (nbG,nbC,propGC)

Ce génome contient 4500 G et 2575 C, soit une prop de GC de 0.48

Remarque :

1.

Dans l’exemple précédent, nous avons utilisé le symbole % pour formater des variables. Si vous avez besoin d’écrire le symbole pourcentage % sans qu’il soit confondu avec celui servant pour l’écriture formatée, il suffit de le doubler. Toutefois, si l’écriture formatée n’est pas utilisée dans la même chaîne de caractères où vous voulez utilisez le symbole pourcent, cette opération n’est pas nécessaire. Par exemple :

>>>

>>>

>>>

>>>

nbG = 4500

nbC = 2575

percGC = propGC 100

*

print « Ce génome contient %i G et %i C, soit un %%GC de %.2f »

% (nbG,nbC,percGC) , »% »

\

Ce génome contient 4500 G et 2575 C, soit un %GC de 47.80 %

Le signe \ en fin de ligne permet de poursuivre la commande sur la ligne suivante. Cette syntaxe est pratique lorsque vous voulez taper une commande longue.

2.

Enfin, il est possible de préciser sur combien de caractères vous voulez qu’un résultat soit écrit. Dans la portion de code suivant, le caractère ; sert de séparateur entre les instructions sur une même ligne :

>>> print 10 ; print 100 ; print 1000

10

100

1000

>>> print « %4i » % 10 ; print « %4i » % 100 ; print « %4i » % 1000 10

100

1000

>>>

Ceci est également possible sur les chaînes de caractères (avec %s, s comme string) :

14

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

3.2 Exercices

3 Écriture

>>> print « atom atom HN

atom HDE1

>>> print « atom atom HN

atom HDE1

HN » ; print « atom HDE1″

%4s » % « HN » ; print « atom %4s » % « HDE1 »

Vous voyez tout de suite l’énorme avantage de l’écriture formatée. Cela permet d’écrire en colonnes parfaitement alignées. Nous verrons que ceci est très pratique si l’on veut écrire les coordonnées des atomes d’une molécule au format PDB.

3.2 Exercices

Conseil : utilisez l’interpréteur Python pour les exercices 2 à 5.

1.

Ouvrez l’interpréteur Python et tapez 1+1. Que se passe-t-il ? Écrivez la même chose dans un script test.py. Exécutez ce script en tapant python test.py dans un shell. Que se passe-t-il ? Pourquoi ?

Calculez le pourcentage de GC avec le code

percGC = ((4500 + 2575)/14800)*100

puis affichez le résultat. Que se passe-t-il ? Comment expliquez-vous ce résultat ? Corrigez l’instruction précédente pour calculer correctement le pourcentage de GC. Affichez cette valeur avec deux décimales de précision.

Générez une chaîne de caractères représentant un oligonucléotide polyA (AAAA…) de 20 bases de longueurs, sans taper littéralement toutes les bases.

Suivant le modèle du dessus, générez en une ligne de code un polyA de 20 bases suivi d’un polyGC régulier (GCGCGC…) de 40 bases.

En utilisant l’écriture formatée, affichez en une seule ligne les variables a, b et c dont les valeurs sont respectivement « salut », 102 et 10.318.

2.

3.

4.

5.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

15

4 Listes

  1. Listes
    1. Définition

Une liste est une structure de données qui contient une série de valeurs. Python autorise la construction de liste contenant des valeurs de type différent (par exemple entier et chaîne de caractères), ce qui leur confère une grande flexibilité. Une liste est déclarée par une série de valeurs (ne pas oublier les guillemets, simples ou doubles, s’il s’agit de chaînes de caractères) séparées par des virgules, et le tout encadré par des crochets. En voici quelques exemples :

>>>

>>>

>>>

>>>

animaux tailles mixte = animaux

= [‘girafe’,’tigre’,’singe’,’souris’]

= [5, 2.5, 1.75, 0.15]

[‘girafe’, 5, ‘souris’, 0.15]

[‘girafe’, ‘tigre’, ‘singe’, ‘souris’]

>>> [5,

>>>

tailles

2.5, 1.75, 0.15]

mixte

[‘girafe’, 5, ‘souris’, 0.15]

Lorsque l’on affiche une liste, Python la restitue telle qu’elle a été saisie.

4.2 Utilisation

Un des gros avantages d’une liste est que vous pouvez appeler ses éléments par leur posi- tion. Ce numéro est appelé indice (ou index) de la liste.

liste : [‘girafe’, ‘tigre’, ‘singe’, ‘souris’]

indice :

0

1

2

3

Soyez très attentifs au fait que les indices d’une liste de n éléments commence à 0 et se termine à n-1. Voyez l’exemple suivant :

>>> animaux = [‘girafe’,’tigre’,’singe’,’souris’]

>>> animaux[0] ‘girafe’

>>> animaux[1] ‘tigre’

>>> animaux[3] ‘souris’

Par conséquent, si on appelle l’élément d’indice 4 de notre liste, Python renverra un message d’erreur :

>>> animaux[4]

Traceback (innermost last): File « <stdin> », line 1, in ?

IndexError: list index out of range

N’oubliez pas ceci ou vous risqueriez d’obtenir des bugs inattendus !

4.3 Opération sur les listes

Tout comme les chaînes de caractères, les listes supportent l’opérateur + de concaténation, ainsi que l’opérateur * pour la duplication :

16

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

4.4 Indiçage négatif et tranches

4 Listes

>>>

>>>

>>>

ani1 ani2 ani1

=

=

+

[‘girafe’,’tigre’]

[‘singe’,’souris’] ani2

‘tigre’, ‘singe’, ‘souris’] 3

‘tigre’, ‘girafe’, ‘tigre’, ‘girafe’, ‘tigre’]

[‘girafe’,

>>> ani1

*

[‘girafe’,

4.4 Indiçage négatif et tranches

La liste peut également être indexée avec des nombres négatifs selon le modèle suivant :

liste indice indice

:

:

:

[‘girafe’,

0

-4

‘tigre’,

1

-3

‘singe’,

2

-2

‘souris’]

3

-1

positif négatif

ou encore :

liste

:

:

:

[‘A’,’C’,’D’,’E’,’F’,’G’,’H’,’I’,’K’,’L’]

indice indice

positif negatif

0

-10

1

-9

2

-8

3

-7

4

-6

5

-5

6

-4

7 8

-3 – 2

9

-1

Les indices négatifs reviennent à compter à partir de la fin. Leur principal avantage est que vous pouvez appeler le dernier élément d’une liste à l’aide de l’indice -1 sans pour autant connaître la longueur de la liste.

>>> animaux = [‘girafe’,’tigre’,’singe’,’souris’]

>>> animaux[-4] ‘girafe’

>>> animaux[-2] ‘singe’

>>> animaux[-1] ‘souris’

Un autre avantage des listes est la possibilité de sélectionner une partie en utilisant un indiçage construit sur le modèle [m:n+1] pour récupérer tous les éléments, du émième au énième (de l’élément m inclus à l’élément n+1 exclus). On dit alors qu’on récupère une tranche de la liste, par exemple :

>>> animaux = [‘girafe’, ‘tigre’, ‘singe’, ‘souris’]

>>> animaux[0:2] [‘girafe’, ‘tigre’]

>>> animaux[0:3]

[‘girafe’, ‘tigre’,

>>> animaux[0:] [‘girafe’, ‘tigre’,

>>> animaux[:] [‘girafe’, ‘tigre’,

>>> animaux[1:]

‘singe’]

‘singe’, ‘souris’]

‘singe’, ‘souris’]

[‘tigre’, ‘singe’, ‘souris’]

>>> animaux[1:-1] [‘tigre’, ‘singe’]

Remarquez que lorsqu’aucun indice n’est indiqué à gauche ou à droite du symbole : , Python prend par défaut tous les éléments depuis le début ou tous les éléments jusqu’à la fin respectivement.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

17

4 Listes

4.5 Fonctions range et len

Dans les versions récentes de Python, on peut aussi préciser le pas en ajoutant un : supplé- mentaire et en indiquant le pas par un entier.

>>> animaux = [‘girafe’, ‘tigre’, ‘singe’, ‘souris’]

>>> animaux[0:3:2] [‘girafe’, ‘singe’]

>>>

>>> [0,

>>> [0,

>>> [0,

>>> [0,

>>> [1,

x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]

x

1, 2, 3,

x[::1]

1, 2, 3,

x[::2]

2, 4, 6,

x[::3]

3, 6, 9]

x[1:6:3] 4]

4, 5, 6, 7, 8, 9]

4, 5, 6, 7, 8, 9]

8]

Finalement, on voit que l’accès au contenu d’une liste avec des crochets fonctionne sur le modèle liste[début:fin:pas].

4.5 Fonctions range et len

L’instruction range() vous permet de créer des listes d’entiers (et d’entiers uniquement) de manière simple et rapide. Voyez plutôt :

>>> [0,

>>> [0,

>>>

range(10)

1, 2, 3, 4, 5, 6, 7, 8, 9]

range(0,5) 1, 2, 3, 4]

range(15,20)

[15, 16, 17, 18, 19]

>>> [0,

>>> [2,

range(0,1000,200) 200, 400, 600, 800]

range(2,-2,-1) 1, 0, -1]

L’instruction range() fonctionne sur le modèle range([début,] fin[, pas]). Les arguments entre crochets sont optionnels.

L’instruction len() vous permet de connaître la longueur d’une liste, ce qui parfois est bien pratique lorsqu’on lit un fichier par exemple, et que l’on ne connaît pas a priori la longueur des lignes. Voici un exemple d’utilisation :

>>>

>>> 4

>>> 10

animaux = [‘girafe’, ‘tigre’, ‘singe’, ‘souris’] len(animaux)

len(range(10))

4.6

Listes de listes

Pour finir, sachez qu’il est tout-à-fait possible de construire des listes de listes. Cette fonc-

tionnalité peut être parfois très pratique. Par exemple :

18

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

4.7 Exercices

4 Listes

>>>

>>>

>>>

>>>

>>>

enclos1 enclos2 enclos3

=

=

=

[‘girafe’, 4]

[‘tigre’, 2]

[‘singe’, 5]

zoo = [enclos1, enclos2, enclos3] zoo

[[‘girafe’, 4], [‘tigre’, 2], [‘singe’, 5]]

Dans cet exemple, chaque sous-liste contient une catégorie d’animal et le nombre d’animaux pour chaque catégorie. Pour accéder à un élément de la sous-liste, on utilise un double indiçage.

>>> zoo[1] [‘tigre’, 2]

>>> zoo[1][0]

‘tigre’

>>> zoo[1][1] 2

On verra un peu plus loin qu’il existe en Python les dictionnaires qui sont très pratiques pour faire ce genre de choses. On verra aussi qu’il existe un module nommé numpy permet- tant de gérer des listes ou tableaux de nombres (vecteurs et matrices), ainsi que de faire des opérations dessus.

4.7 Exercices

Conseil : utilisez l’interpréteur Python.

1.

Constituez une liste semaine contenant les 7 jours de la semaine. À partir de cette liste, comment récupérez-vous seulement les 5 premiers jours de la semaine d’une part, et ceux du week-end d’autre part (utilisez pour cela l’indiçage) ? Cherchez un autre moyen pour arriver au même résultat (en utilisant un autre indiçage).

Trouvez deux manières pour accéder au dernier jour de la semaine. Inversez les jours de la semaine en une commande.

Créez 4 listes hiver, printemps, ete et automne contenant les mois correspondant à

ces saisons. Créez ensuite une liste saisons contenant les sous-listes hiver, printemps,ete et automne. Prévoyez ce que valent les variables suivantes, puis vérifiez-le dans l’inter- préteur :

2.

3.

4.

saisons[2] saisons[1][0] saisons[1:2] saisons[:][1]

Comment expliquez-vous ce dernier résultat ?

Affichez la table des 9 en une seule commande avec l’instruction range().

Avec Python, répondez à la question suivante en une seule commande. Combien y a-t-il de nombres pairs dans l’intervalle [2 , 10000] inclus ?

5.

6.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

19

5 Boucles et comparaisons

  1. Boucles et comparaisons
    1. Boucles for

Imaginez que vous ayez une liste de quatre éléments dont vous voulez afficher les éléments les uns après les autres. Dans l’état actuel de vos connaissances, il faudrait taper quelque chose du style :

animaux = [‘girafe’,’tigre’,’singe’,’souris’]

print print print print

animaux[0] animaux[1] animaux[2] animaux[3]

Si votre liste ne contient que quatre éléments, ceci est encore faisable mais imaginez qu’elle en contienne 100 voire 1000 ! Pour remédier à cela, il faut utiliser les boucles. Regardez l’exemple suivant :

>>>

>>>

animaux = [‘girafe’,’tigre’,’singe’,’souris’] for i in animaux:

print i

girafe tigre singe souris

En fait, la variable i va prendre successivement les différentes valeurs de la liste animaux à chacune de ses itérations. D’ores et déjà, remarquez avec attention l’indentation. Vous voyez que l’instruction print i est décalée par rapport à l’instruction for i in animaux:. Outre une meilleure lisibilité, ceci est formellement requis en Python. Toutes les instructions que l’on veut répéter constituent le corps de la boucle (ou un bloc d’instructions) et doivent être inden- tées d’un(e) ou plusieurs espace(s) ou tabulation(s). Dans le cas contraire, Python vous renvoie un message d’erreur :

>>> for i in animaux:

… print i

File « <stdin> », line 2 print i

^

IndentationError: expected an indented block

Notez également que si le corps de votre boucle contient plusieurs instructions, celles-ci doivent être indentées de la même manière (e.g. si vous avez indenté la première instruction avec deux espaces, vous devez faire de même avec la deuxième instruction, etc).

Remarquez également un autre aspect de la syntaxe, une instruction for doit absolument

se terminer par le signe deux-points:.

Il est aussi possible d’utiliser une tranche d’une liste :

>>>

>>>

animaux = [‘girafe’,’tigre’,’singe’,’souris’]

for

i in animaux[1:3]: print i

tigre singe

20

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

5.1 Boucles for

5 Boucles et comparaisons

On a vu que les boucles for pouvaient utiliser une liste contenant des chaînes de carac- tères, mais elles peuvent tout aussi bien utiliser des listes numériques. En utilisant l’instruction range on peut facilement accéder à une liste d’entiers.

>>> for i in range(4):

… 0

1

2

3

print i

Par conséquent, vous pouvez utiliser les boucles comme une itération sur les indices des éléments d’une liste.

>>>

>>>

animaux = [‘girafe’, ‘tigre’, ‘singe’, ‘souris’] for i in range(4):

print animaux[i]

girafe tigre singe souris

Cependant, la méthode à utiliser pour parcourir avec une boucle for les éléments d’une liste est celle qui réalise les itérations directement sur les élements.

>>>

>>>

animaux = [‘girafe’,’tigre’,’singe’,’souris’] for i in animaux:

print i

girafe tigre singe souris

Si vous avez besoin de parcourir votre liste par ses indices, préférez la fonction xrange() qui s’utilise de la même manière que range() mais qui ne construit pas de liste et qui est donc beaucoup plus rapide. La fonction range() ne sera donc employée que pour créer des listes d’entiers.

>>>

>>>

animaux = [‘girafe’,’tigre’,’singe’,’souris’] for i in xrange(4):

print animaux[i]

girafe tigre singe souris

Enfin, si vous avez besoin de l’indice d’un élément d’une liste et de l’élément lui-même, la fonction enumerate() est pratique.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

21

5 Boucles et comparaisons

5.2 Comparaisons

>>>

>>>

animaux = [‘girafe’,’tigre’,’singe’,’souris’] for i, ani in enumerate(animaux):

print i, ani

0

1

2

3

girafe tigre singe souris

5.2 Comparaisons

Avant de passer à une autre sorte de boucles (les boucles while), nous abordons tout de suite les comparaisons. Celles-ci seront reprises dans le chapitre des tests. Python est capable d’effectuer toute une série de comparaisons entre le contenu de différentes variables, telles que :

syntaxe

==

!=

>

>=

<

<=

Python

signification égal à différent supérieur supérieur inférieur inférieur

de

à

ou égal à à

ou égal à

Observez l’exemple suivant sur des nombres entiers.

>>> x

>>> x

True

>>> x

False

>>> x

True

= 5

== 5

> 10

< 10

Python renvoie la valeur True si la comparaison est vraie et False si elle est fausse. True

et False sont des booléens.

Faites bien attention à ne pas confondre l’opérateur d’affectation = qui donne une valeur à une variable et l’opérateur de comparaison == qui compare les valeurs de deux variables.

Vous pouvez également effectuer des comparaisons sur des chaînes de caractères.

>>> animal

>>> animal False

>>> animal True

>>> animal True

= « tigre »

==

« tig »

!=

« tig »

==

‘tigre’

Dans le cas des chaînes de caractères, a priori seuls les tests == et != ont un sens. En fait, on peut aussi utiliser les opérateurs <, >, <= et >=. Dans ce cas l’ordre alphabétique est pris en compte, par exemple :

>>> « a » < « b »

True

22

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

5.3 Boucles while

5 Boucles et comparaisons

« a » est inférieur à « b » car il est situé avant dans l’ordre alphabétique. En fait, c’est l’ordre ASCII des caractères qui est pris en compte (i.e. chaque caractère est affecté à un code numérique), on peut donc comparer aussi des caractères spéciaux (comme # ou ~) entre eux. On peut aussi comparer des chaînes à plus d’un caractère.

>>> « ali » < « alo » True

>>> « abb » < « ada » True

Dans ce cas, Python compare caractère par caractère de la gauche vers la droite (le premier avec le premier, le deuxième avec le deuxième, etc). Dès qu’un caractère est différent entre l’une et l’autre des chaînes, il considère que la chaîne « la plus petite » est celle qui présente le caractère ayant le plus petit code ASCII (les caractères suivants de la chaîne sont ignorés dans la comparaison), comme dans notre test « abb » < « ada » ci-dessus.

5.3 Boucles while

Une autre alternative à l’instruction for couramment utilisée en informatique est la boucle while. Le principe est simple. Une série d’instructions est exécutée tant qu’une condition est vraie. Par exemple :

>>>

>>>

… 1

2

3

4

i = 1

while i <= 4:

print i i = i + 1

Remarquez qu’il est encore une fois nécessaire d’indenter le bloc d’instructions. Une boucle

while nécessite trois éléments pour fonctionner correctement :

1.

2.

3.

l’initialisation de la variable de test avant la boucle ; le test de la variable associé à l’instruction while ;

l’incrémentation de la variable de test dans le corps de la boucle.

Faites bien attention aux tests et à l’incrémentation que vous utilisez car une erreur mène souvent à des boucles infinies qui ne s’arrètent pas. Vous pouvez néanmoins toujours stopper l’exécution d’un script Python à l’aide de la combinaison de touches Ctrl-C.

5.4 Exercices

Conseil : pour ces exercices, écrivez des scripts dans des fichiers, puis exécutez-les dans un

shell.

1.

Soit la liste [‘vache’,’souris’,’levure’,’bacterie’]. Affichez l’ensemble des éléments de cette liste (un élément par ligne) de trois manières différentes (deux avec for et une avec while).

Constituez une liste semaine contenant les 7 jours de la semaine. Écrivez une série d’ins- tructions affichant les jours de la semaine (en utiliser une boucle for), ainsi qu’une autre série d’instructions affichant les jours du week-end (en utilisant une boucle while).

Avec une boucle, affichez les nombres de 1 à 10 sur une seule ligne.

2.

3.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

23

5

Boucles et comparaisons

5.4

Exercices

4.

Soit impairs la liste de nombres [1,

19, 21].

3, 5, 7, 9, 11, 13, 15, 17,

Écrivez un programme qui, à partir de la liste impairs, construit une liste pairs dans laquelle tous les éléments de impairs sont incrémentés de 1.

5.

Voici les notes d’un étudiant [14, 9, 6, 8, 12]. Calculez la moyenne de ces notes. Utilisez l’écriture formatée pour afficher la valeur de la moyenne avec deux décimales.

Soit la liste X contenant les nombres entiers de 0 à 10. Calculez le produit des nombres consécutifs deux à deux de X en utilisant une boucle. Exemple pour les premières itéra- tions :

0

2

6

12

Triangle. Écrivez un script qui dessine un triangle comme celui-ci :

*

**

***

****

*****

******

*******

********

*********

**********

Triangle inversé. Écrivez un script qui dessine un triangle comme celui-ci :

**********

*********

********

*******

******

*****

****

***

**

*

Triangle gauche. Écrivez un script qui dessine un triangle comme celui-ci :

*

**

***

****

*****

******

*******

********

*********

**********

6.

7.

8.

9.

24

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

5.4 Exercices

5 Boucles et comparaisons

10.

Triangle isocèle. Écrivez un script qui dessine un triangle comme celui-ci :

*

***

*****

*******

*********

***********

*************

***************

*****************

*******************

Exercice +++. Suite de Fibonacci. La suite de Fibonacci est une suite mathématique qui porte le nom de Leonardo Fibonacci, un mathématicien italien du XIIIe siècle. Initiale- ment, cette suite a été utilisée pour décrire la croissance d’une population de lapins mais elle est peut également être utilisée pour décrire certains motifs géométriques retrouvés dans la nature (coquillages, fleurs de tournesol…).

Par définition, les deux premiers termes de la suite de Fibonacci sont 0 et 1. Ensuite, le terme au rang n est la somme des nombres aux rangs n – 1 et n – 2. Par exemple, les 10 premiers termes de la suite de Fibonacci sont 0, 1, 1, 2, 3, 5, 8, 13, 21, 34.

Écrivez un script qui construit la liste des 20 premiers termes de la suite de Fibonacci puis l’affiche.

11.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

25

6 Tests

  1. Tests
    1. Définition

Les tests sont un élément essentiel à tout langage informatique si on veut lui donner un peu de complexité car ils permettent à l’ordinateur de prendre des décisions si telle ou telle condi- tion est vraie ou fausse. Pour cela, Python utilise l’instruction if ainsi qu’une comparaison que nous avons abordée au chapitre précédent. En voici un exemple :

>>>

>>>

x = 2

if x == 2:

print « Le test est vrai ! »

Le test

est vrai ! « tigre »

>>>

>>>

x =

if x == « tigre »:

print « Le test est vrai ! »

Plusieurs remarques concernant ces deux exemples :

Dans le premier exemple, le test étant vrai, l’instruction print « Le test est vrai ! »

est exécutée. Dans le second exemple, le test est faux et rien n’est affiché.

Les blocs d’instruction dans les tests doivent forcément être indentés comme les boucles for et while. L’indentation indique la portée des instructions à exécuter si le test est vrai.

L’instruction if se termine comme les instructions for et while par le caractère :.

6.2

Tests à plusieurs cas

Parfois, il est pratique de tester si la condition est vraie ou si elle est fausse dans une même

instruction if. Plutôt que d’utiliser deux instructions if, on peut se servir de if et de else :

>>>

>>>

x = 2

if x == 2:

print « Le test else:

print « Le test

est

vrai

! »

est

faux

! »

Le test

est vrai ! 3

>>>

>>>

x =

if x == 2:

print « Le test else:

print « Le test

est

vrai

! »

est

faux

! »

Le test est faux !

On peut utiliser une série de tests dans la même instruction if, notamment pour tester plusieurs valeurs d’une même variable. Par exemple, on se propose de tirer au sort une base d’ADN puis d’afficher le nom de cette dernière. Dans le code suivant, nous utilisons l’intruction random.choice(liste) qui renvoie un élément choisi au hasard dans une liste. L’instruc- tion import random sera vue plus tard, admettez pour le moment qu’elle est nécessaire.

>>> import random

26

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

6.3 Tests multiples

6 Tests

>>>

>>>

base = random.choice([« a », « t », « c », « g »]) if base == « a »:

print elif base

print elif base

print elif base

print

« choix d’une

== « t »:

« choix d’une

== « c »:

« choix d’une

== « g »:

« choix d’une

adénine »

thymine »

cytosine »

guanine »

choix d’une cytosine

Dans cet exemple, Python teste la première condition, puis, si et seulement si elle est fausse, teste la deuxième et ainsi de suite… Le code correspondant à la première condition vérifiée est exécuté puis Python sort du if.

Remarque De nouveau, faites bien attention à l’indentation dans ces deux derniers exemples ! Vous devez être très rigoureuxà ce niveau là. Pour vous en convaincre, exécutez ces deux scripts dans l’interpréteur Python :

Script 1 :

nombres = [4, 5, 6] for i in nombres:

if i == 5:

print print

« Le test est vrai »

« car la variable i vaut », i

Script 2 :

nombres = [4,

5, 6]

for i in nombres: if i == 5:

print « Le test est vrai » print « car la variable i vaut », i

Comment expliquez-vous ce résultat ?

6.3 Tests multiples

Les tests multiples permettent de tester plusieurs conditions en même temps en utilisant des opérateurs booléens. Les deux opérateurs les plus couramment utilisés sont le OU et le ET. Voici un petit rappel du mode de fonctionnement de ces opérateurs :

Condition

1

Opérateur

Condition

2

Résultat

Vrai Vrai Faux Faux

OU OU OU OU

Vrai Faux Vrai Faux

Vrai Vrai Vrai Faux

Vrai Vrai Faux Faux

ET ET ET ET

Vrai Faux Vrai Faux

Vrai Faux Faux Faux

En Python, on utilise le mot réservé and pour l’opérateur ET et le mot réservé or pour l’opérateur OU. Respectez bien la casse, and et or s’écrivent en minuscule. En voici un exemple d’utilisation :

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

27

6 Tests

6.4 Instructions break et continue

>>>

>>>

>>>

x =

y =

2

2

if x == 2 and y == 2:

print « le test est vrai »

le test est vrai

Notez que le même résulat serait obtenu en utilisant deux instructions if imbriquées :

>>>

>>>

>>>

x = 2

y = 2

if

x == 2:

if y == 2:

print « le test est vrai »

le test

est vrai

Vous pouvez aussi tester directement l’effet de ces opérateurs à l’aide de True et False

(attention à respecter la casse).

>>> True or False True

Enfin, on peut utiliser l’opérateur logique de négation not qui inverse le résultat d’une condition :

>>> not False

>>> not True

>>> not False

True

False

(True and True)

6.4 Instructions break et continue

Ces deux instructions permet de modifier le comportement d’une boucle (for ou while) avec un test.

L’instruction break stoppe la boucle.

>>>

… 0

1

2

for

i in range(5): if i > 2:

break print i

L’instruction continue saute à l’itération suivante.

>>>

for

i in range(5): if i == 2:

continue print i

28

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

6.5 Exercices

6 Tests

… 0

1

3

4

6.5 Exercices

Conseil : pour ces exercices, écrivez des scripts dans des fichiers, puis exécutez-les dans un

shell.

1.

Constituez une liste semaine contenant les sept jours de la semaine. En utilisant une boucle, écrivez chaque jour de la semaine ainsi que les messages suivants :

– Au travail s’il s’agit du lundi au jeudi

Chouette c’est vendredi s’il s’agit du vendredi

Repos ce week-end s’il s’agit du week-end.

(Les messages ne sont que des suggestions, vous pouvez laisser aller votre imagination.) La liste ci-dessous représente une séquence d’ADN :

[« A », »C », »G », »T », »T », »A », »G », »C », »T », »A », »A », »C », »G »]

Écrivez un script qui transforme cette séquence en sa séquence complémentaire. Rappel : la séquence complémentaire s’obtient en remplaçant A par T, T par A, C par G et G par C.

La fonction min() de Python, renvoie l’élément le plus petit d’une liste. Sans utiliser cette fonction, écrivez un script qui détermine le plus petit élément de la liste [8, 4, 6, 1, 5].

La liste ci-dessous représente une séquence d’acides aminés

2.

3.

4.

[« A », »R », »A », »W », »W », »A », »W », »A », »R », »W », »W », »R », »A », »G », »A », »R »]

Calculez la fréquence en alanine (A), arginine (R), tryptophane (W) et glycine (G) dans cette séquence.

Voici les notes d’un étudiant [14, 9, 13, 15, 12]. Écrivez un script qui affiche la note maximum (fonction max()), la note minimum (fonction min()) et qui calcule la moyenne. Affichez la valeur de la moyenne avec deux décimales. Affichez aussi la men- tion obtenue sachant que la mention est passable si la moyenne est entre 10 inclus et 12 exclus, assez-bien entre 12 inclus et 14 exclus et bien au-delà de 14.

Faites une boucle qui parcourt les nombres de 0 à 20 et qui affiche les nombres pairs inférieurs ou égaux à 10 d’une part, et les nombres impairs strictement supérieur à 10 d’autre part. Pour cet exercice, vous pourrez utiliser l’opérateur modulo % qui retourne le reste de la division entière entre deux nombres.

Exercice +++. Conjecture de Syracuse.

La conjecture de Syracuse est une conjecture mathématique qui reste improuvée à ce jour et qui est définie de la manière suivante.

Soit un entier positif n. Si n est pair, alors le diviser par 2. Si il est impair, alors le multiplier par 3 et lui ajouter 1. En répétant cette procédure, la suite de nombres atteint la valeur 1 puis se prolonge indéfiniment par une suite de trois valeurs triviales appelée cycle trivial. Jusqu’à présent, la conjecture de Syracuse, selon laquelle depuis n’importe quel entier positif la suite de Syracuse atteint 1, n’a pas été mise en défaut.

Par exemple, les premiers éléments de la suite de Syracuse pour un entier de départ de 10 sont : 10, 5, 16, 8, 4, 2, 1…

Écrivez un script qui, partant d’un entier positif n, crée une liste des nombres de la suite de Syracuse. Avec différents points de départ (n), la conjecture de Syracuse est-elle toujours vérifiée ? Quels sont les nombres qui constituent le cycle trivial ?

5.

6.

7.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

29

6

Tests

6.5 Exercices

Remarque 1 : pour cet exercice, vous avez besoin de faire un nombre d’itérations inconnu pour que la suite de Syracuse atteigne 1 puis entame son cycle trivial. Vous pourrez tester votre algorithme avec un nombre arbitraire d’itérations, typiquement 20 ou 100, suivant votre nombre n de départ.

Remarque 2 : un nombre est pair lorsque le reste de sa division entière (opérateur modulo

%) par 2 est nul.

Exercice +++. Attribution simple de structure secondaire.

Les angles dièdres phi/psi d’une hélice alpha parfaite ont une valeur de -57 degrés et

-47 degrés respectivement. Bien sûr, il est très rare que l’on trouve ces valeurs parfaites dans une protéine, par conséquent il est couramment accepté de tolérer une déviation de

+/- 30 degrés sur celles-ci. Ci-dessous vous avez une liste de listes contenant les valeurs de phi/psi de la première hélice de la protéine 1TFE. À l’aide de cette liste, écrivez un programme qui teste, pour chacun des résidus, s’ils sont ou non en hélice.

8.

[[48.6,53.4],[-124.9,156.7],[-66.2,-30.8],[-58.8,-43.1],

[-73.9,-40.6],[-53.7,-37.5],[-80.6,-16.0],[-68.5,135.0],

[-64.9,-23.5],[-66.9,-45.5],[-69.6,-41.0],[-62.7,-37.5],

[-68.2,-38.3],[-61.2,-49.1],[-59.7,-41.1],[-63.2,-48.5],

[-65.5,-38.5],[-64.1,-40.7],[-63.6,-40.8],[-66.4,-44.5],

[-56.0,-52.5],[-55.4,-44.6],[-58.6,-44.0],[-77.5,-39.1],

[-91.7,-11.9],[48.6,53.4]]

Exercice +++. Détermination des nombres premiers inférieurs à 100.

\

\

\

\

\

\

9.

Voici un extrait de l’article sur les nombres premiers tiré de l’encyclopédie en ligne wiki- pédia.

« Un nombre premier est un entier naturel qui admet exactement deux diviseurs distincts entiers et positifs (qui sont alors 1 et lui-même). Cette définition exclut 1, qui n’a qu’un seul diviseur entier positif. Par opposition, un nombre non nul produit de deux nombres entiers différents de 1

est dit composé. Par exemple 6 = 2 × 3 est composé, tout comme 21 = 3 × 7, mais 11 est premier

car 1 et 11 sont les seuls diviseurs de 11. Les nombres 0 et 1 ne sont ni premiers ni composés. » Déterminez les nombres premiers inférieurs à 100. Combien y a-t-il de nombres premiers entre 0 et 100 ? Pour vous aider, nous vous proposons deux méthodes.

Méthode 1 (peu optimale mais assez intuitive)

Pour chaque nombre de 2 à 100, calculez le reste de la division entière (avec l’opérateur modulo %) depuis 1 jusqu’à lui-même. Si c’est un nombre premier, il aura exactement deux nombres pour lesquels le reste de la division entière est égal à 0 (1 et lui-même). Si ce n’est pas un nombre premier, il aura plus de deux nombres pour lesquels le reste de la division entière est égal à 0.

Méthode 2 (plus optimale et plus rapide, mais un peu plus compliquée)

Vous pouvez parcourir tous les nombres de 2 à 100 et vérifier si ceux-ci sont composés, c’est-à-dire qu’ils sont le produit de deux nombres premiers. Pratiquement, cela consiste à vérifier que le reste de la division entière (opérateur modulo %) entre le nombre considéré et n’importe quel nombre premier est nul. Le cas échéant, ce nombre n’est pas premier.

30

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

7 Fichiers

  1. Fichiers
    1. Lecture dans un fichier

Dans la plupart des travaux de programmation, on doit lire ou écrire dans un fichier. Python possède pour cela tout un tas d’outils qui vous simplifient la vie. Avant de passer à un exemple concret, créez un fichier dans un éditeur de texte que vous enregistrerez dans votre répertoire avec le nom zoo.txt, par exemple :

girafe tigre singe souris

Ensuite, testez cet exemple :

>>> filin = open(‘zoo.txt’, ‘r’)

>>> filin

<open file ‘zoo.txt’, mode ‘r’ at 0x7f8ea16efc00>

>>> filin.readlines()

[‘girafe\n’, ‘tigre\n’, ‘singe\n’, ‘souris\n’]

>>> filin.close()

>>> filin

<closed file ‘zoo.txt’, mode ‘r’ at 0x7f8ea16efc00>

La première commande ouvre le fichier zoo.txt en lecture seule (ceci est indiqué avec la lettre r). Remarquez que le fichier n’est pas encore lu, mais simplement ouvert (un peu comme lorsqu’on ouvre un livre, mais qu’on ne l’a pas encore lu). Lorsqu’on affiche la valeur de la variable filin, vous voyez que Python la considère comme un objet de type fichier

<open file ‘zoo.txt’, mode ‘r’ at 0x7f8ea16efc00>

Et oui, Python est un langage orienté objet. Retenez seulement que l’on peut considérer chaque variable comme un objet sur lequel on peut appliquer des méthodes.

À propos de méthode, on applique la méthode readlines() sur l’objet filin dans l’instruction suivante (remarquez la syntaxe du type objet.méthode). Ceci nous retourne une liste contenant toutes les lignes du fichier (dans notre analogie avec un livre, ceci corres- pondrait à lire les lignes du livre).

Enfin, on applique la méthode close() sur l’objet filin, ce qui vous vous en doutez, va fermer le fichier (ceci correspondrait bien sûr à fermer le livre). On pourra remarquer que l’état de l’objet a changé

<closed file ‘zoo.txt’, mode ‘r’ at 0x7f8ea16efc00>

Vous n’avez bien-sûr pas à retenir ces concepts d’objets pour pouvoir programmer avec Python, nous avons juste ouvert cette parenthèse pour attirer votre attention sur la syntaxe.

Remarque : n’utilisez jamais le mot file comme nom de variable pour un fichier car file

est un mot réservé de Python.

Voici maintenant un exemple complet de lecture d’un fichier avec Python.

>>>

>>>

>>>

filin = open(‘zoo.txt’, ‘r’)

lignes = lignes

filin.readlines()

[‘girafe\n’,

>>> for i in

‘tigre\n’, ‘singe\n’, ‘souris\n’] lignes:

print i

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

31

7 Fichiers

7.1 Lecture dans un fichier

girafe

tigre

singe

souris

>>> filin.close()

Vous voyez qu’en cinq lignes de code, vous avez lu et parcouru le fichier.

Remarques :

Notez que la liste lignes contient le caractère \n à la fin de chacun de ses éléments.

Ceci correspond au saut à la ligne de chacune d’entre elles (ceci est codé par un caractère spécial que l’on symbolise par \n). Vous pourrez parfois rencontrer également la notation octale \012.

Remarquez aussi que lorsque l’on affiche les différentes lignes du fichier à l’aide de la boucle for et de l’instruction print, Python saute à chaque fois une ligne.

Méthode read()

Il existe d’autres méthodes que readlines() pour lire (et manipuler) un fichier. Par exemple, la méthode read() lit tout le contenu d’un fichier et renvoie une chaîne de caractères unique.

>>> filin = open(‘zoo.txt’, ‘r’)

>>> filin.read() ‘girafe\ntigre\nsinge\nsouris\n’

>>> filin.close()

Méthode readline()

La méthode readline() (sans s) lit une ligne d’un fichier et la renvoie sous forme d’une chaîne de caractères. À chaque nouvel appel de readline(), la ligne suivante est renvoyée. Associée à la boucle while, cette méthode permet de lire un fichier ligne par ligne.

>>>

>>>

>>>

filin ligne while

= open(‘zoo.txt’, ‘r’)

= filin.readline() ligne != «  »:

print ligne

ligne = filin.readline()

girafe

tigre

singe

souris

>>> filin.close()

32

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

7.2 Écriture dans un fichier

7 Fichiers

Méthodes seek() et tell()

Les méthodes seek() et tell() permettent respectivement de se déplacer au nième carac- tère (plus exactement au nième octet) d’un fichier et d’afficher où en est la lecture du fichier, c’est-à-dire quel caractère (ou octet) est en train d’être lu.

>>> filin = open(‘zoo.txt’, ‘r’)

>>> filin.readline() ‘girafe\n’

>>> 7

>>>

>>> 0

>>>

filin.tell()

filin.seek(0) filin.tell()

filin.readline()

‘girafe\n’

>>> filin.close()

On remarque qu’à l’ouverture d’un fichier, le tout premier caractère est considéré comme le caractère 0 (tout comme le premier élément d’une liste). La méthode seek() permet facilement de remonter au début du fichier lorsque l’on est arrivé à la fin ou lorsqu’on en a lu une partie.

Itérations directement sur le fichier

Python essaie de vous faciliter la vie au maximum. Voici un moyen à la fois simple et élégant de parcourir un fichier.

>>>

>>>

filin = open(‘zoo.txt’, ‘r’) for li in filin:

print li

girafe

tigre

singe

souris

>>> filin.close()

La boucle for va demander à Python d’aller lire le fichier ligne par ligne. Privilégiez cette méthode par la suite.

7.2 Écriture dans un fichier

Écrire dans un fichier est aussi simple que de le lire. Voyez l’exemple suivant :

>>>

>>>

>>>

>>>

animaux2 filout = for i in

= [‘poisson’, ‘abeille’, ‘chat’]

open(‘zoo2.txt’, ‘w’) animaux2:

filout.write(i)

filout.close()

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

33

7 Fichiers

7.3 Exercices

Le contenu du fichier zoo2.txt est poissonabeillechat. Quelques commentaires sur cet exemple :

  • Après avoir initialisé la liste animaux2, nous avons ouvert un fichier mais cette fois-ci en mode écriture (avec le caractère w).
  • Ensuite, on a balayé cette liste à l’aide d’une boucle. À chaque itération, nous avons écrit chaque élément de la liste dans le fichier. Remarquez à nouveau la méthode write() qui s’applique sur l’objet filout.
  • Enfin, on a fermé le fichier avec la méthode close().

Vous voyez qu’il est extrêmement simple en Python de lire ou d’écrire dans un fichier.

Remarque. Si votre programme produit uniquement du texte, vous pouvez l’écrire sur la sortie standard (avec l’instruction print). L’avantage est que dans ce cas l’utilisateur peut bénéficier de toute les potentialités d’Unix (redirection, tri, parsing…). S’il veut écrire le résultat du programme dans un fichier, il pourra toujours le faire en redirigeant la sortie.

7.3 Exercices

Conseil : pour les exercices 1 et 2, utilisez l’interpréteur Python. Pour les exercices suivants, écrivez des scripts dans des fichiers, puis exécutez-les dans un shell.

1.

Dans l’exemple ‘girafe’, ‘tigre’, etc, ci-dessus, comment expliquer vous que Python saute une ligne à chaque itération ? Réécrivez les instructions ad-hoc pour que Python écrive le contenu du fichier sans sauter de ligne.

En reprenant le dernier exemple sur l’écriture dans un fichier, vous pouvez constater que les noms d’animaux ont été écrits les uns à la suite des autres, sans retour à la ligne. Comment expliquez-vous ce résultat ? Modifiez les instructions de manière à écrire un animal par ligne.

Dans cet exercice, nous allons utiliser une sortie partielle de DSSP (Define Secondary Struc- ture of Proteins), qui est un logiciel d’extraction des structures secondaires. Ce fichier contient 5 colonnes correspondant respectivement au numéro de résidu, à l’acide aminé, sa structure secondaire et ses angles phi/psi.

2.

3.

Téléchargez le fichier first_helix_1tfe.txt sur le site du cours et sauvegardez-le dans votre répertoire de travail (jetez-y un oeil en passant).

Chargez les lignes de ce fichier en les plaçant dans une liste puis fermez le fichier. Écrivez chaque ligne à l’écran pour vérifier que vous avez bien chargé le fichier. Écrivez dans un fichier output.txt chacune des lignes. N’oubliez pas le retour à la ligne pour chaque acide aminé.

Écrivez dans un fichier output2.txt chacune des lignes suivies du message line checked. Encore une fois, n’oubliez pas les retours à la ligne.

34

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

8 Modules

  1. Modules
    1. Définition

Les modules sont des programmes Python qui contiennent des fonctions que l’on est amené à réutiliser souvent (on les appelle aussi bibliothèques ou libraries). Les développeurs de Python ont mis au point de nombreux modules qui effectuent une quantité phénoménale de tâches. Pour cette raison, prenez le réflexe de vérifier si une partie du code que vous souhaitez écrire n’existe pas déjà sous forme de module. La plupart de ces modules sont déjà installés dans les versions standards de Python. Vous pouvez accéder à une documentation exhaustive sur le site de Python. Surfez un peu sur ce site, la quantité de modules est impressionante.

8.2 Importation de modules

Jusqu’à maintenant, nous avons rencontré une fois cette notion de module lorsque nous avons voulu tirer un nombre aléatoire.

>>> import random

>>> random.randint(0,10) 4

Regardons de plus près cet exemple :

  • L’instruction import permet d’accéder à toutes les fonctions du module random
  • Ensuite, nous utilisons la fonction (ou méthode) randint(a,b) du module random. At- tention cette fonction renvoie un nombre entier aléatoirement entre a inclus et b inclus (contrairement à range() par exemple). Remarquez la notation objet random.randint() où la fonction randint() peut être considérée comme une méthode de l’objet random.

Il existe un autre moyen d’importer une ou des fonctions d’un module :

>>> from random import randint

>>> randint(0,10) 7

À l’aide du mot-clé from, vous pouvez importer une fonction spécifique d’un module donné. Remarquez que dans ce cas il est inutile de répéter le nom du module, seul le nom de ladite fonction est requis.

On peut également importer toutes les fonctions d’un module :

>>>

>>>

>>>

>>> [2,

>>>

>>> [4,

>>> 46

>>>

from random import x = [1, 2, 3, 4]

shuffle(x) x

3, 1, 4]

shuffle(x) x

2, 1, 3]

randint(0,50)

*

uniform(0,2.5)

0.64943174760727951

Comme vous l’avez deviné, l’instruction from random import * importe toutes les fonc- tions du module random. On peut ainsi utiliser toutes ses fonctions directement, comme par exemple shuffle(), qui permute une liste aléatoirement.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

35

8 Modules

8.3 Obtenir de l’aide sur les modules importés

Dans la pratique, plutôt que de charger toutes les fonctions d’un module en une seule fois (from random import *), nous vous conseillons de charger le module (import random) puis d’appeler explicitement les fonctions voulues (random.randint(0,2)).

Enfin, si vous voulez vider de la mémoire un module déjà chargé, vous pouvez utiliser l’instruction del :

>>>

>>> 2

>>>

>>>

import random random.randint(0,10)

del random random.randint(0,10)

Traceback (most recent call last): File « <stdin> », line 1, in ?

NameError: name ‘random’ is not defined

Vous pouvez constater qu’un rappel d’une fonction du module random après l’avoir vidé de la mémoire retourne un message d’erreur.

Enfin, il est également possible de définir un alias (un nom plus court) pour un module :

>>> import random as rand

>>> rand.randint(1, 10)

6

Dans cet exemple, les fonctions du module random sont accessibles via l’alias rand.

8.3 Obtenir de l’aide sur les modules importés

Pour obtenir de l’aide sur un module rien de plus simple, il suffit d’invoquer la commande

help() :

>>> import random

>>> help(random)

On peut se promener dans l’aide avec les flèches ou les touches page-up et page-down (comme dans les commandes Unix man, more ou less). Il est aussi possible d’invoquer de l’aide sur une fonction particulière d’un module de la manière suivante help(random.randint).

La commande help() est en fait une commande plus générale permettant d’avoir de l’aide sur n’importe quel objet chargé en mémoire.

>>> x = range(2)

>>> help(x)

Help on list object:

class list(object)

|

|

|

|

|

|

list() -> new list

list(sequence) -> new list initialized from sequence’s items

Methods defined here:

add (…)

36

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

8.4 Modules courants

8 Modules

x. add (y) <==> x+y

|

|

Enfin, si on veut connaître en seul coup d’oeil toutes les méthodes ou variables associées à un objet, on peut utiliser la commande dir :

>>> import random

>>> dir(random)

[‘BPF’, ‘LOG4’, ‘NV_MAGICCONST’, ‘RECIP_BPF’, ‘Random’, ‘SG_MAGICCONST’, ‘System

‘TWOPI’, ‘WichmannHill’, ‘_BuiltinMethodType’, ‘_MethodType’, ‘ all ‘, ‘ buil

‘ doc ‘, ‘ file ‘, ‘ name ‘, ‘_acos’, ‘_ceil’, ‘_cos’,

‘_inst’, ‘_log’, ‘_pi’, ‘_random’, ‘_sin’, ‘_sqrt’, ‘_test’, ‘_urandom’, ‘_warn’, ‘betavariate’, ‘choice’, ‘expovariate’,

‘_e’, ‘_exp’, ‘_hex ‘_test_generator’, ‘gammavariate’, ‘ga

‘getrandbits’, ‘getstate’, ‘jumpahead’, ‘lognormvariate’, ‘normalvariate’, ‘paretovariate’, ‘randint’, ‘random’, ‘randrange’, ‘sample’, ‘seed’, ‘setstate’, ‘shuffle’, ‘uniform’, ‘vonmisesvariate’, ‘weibullvariate’]

>>>

8.4 Modules courants

Il existe une série de modules que vous serez probablement amenés à utiliser si vous pro- grammez en Python. En voici une liste non exhaustive. Pour la liste complète, reportez-vous à la page des modules sur le site de Python :

math : fonctions et constantes mathématiques de base (sin, cos, exp, pi…). sys : passage d’arguments, gestion de l’entrée/sortie standard…

os : dialogue avec le système d’exploitation (e.g. permet de sortir de Python, lancer une commande en shell, puis de revenir à Python).

random : génération de nombres aléatoires.

time : permet d’accéder à l’heure de l’ordinateur et aux fonctions gérant le temps. calendar : fonctions de calendrier.

profile : permet d’évaluer le temps d’exécution de chaque fonction dans un programme (profiling en anglais).

urllib2 : permet de récupérer des données sur internet depuis python.

Tkinter : interface python avec Tk (permet de créer des objets graphiques ; nécessite d’ins- taller Tk).

re : gestion des expressions régulières.

pickle : écriture et lecture de structures Python (comme les dictionnaires par exemple).

Nous vous conseillons vivement d’aller surfer sur les pages de ces modules pour découvrir toutes leurs potentialités.

Vous verrez plus tard comment créer votre propres modules lorsque vous êtes amenés à réutiliser souvent vos propres fonctions.

Enfin, notez qu’il existe de nombreux autres modules qui ne sont pas installés de base dans Python mais qui sont de grand intérêt en bioinformatique (au sens large). Citons-en quelques- uns : numpy (algèbre linéaire, transformée de Fourier), biopython (recherche dans les banques de données biologiques), rpy (dialogue R/Python)…

8.5 Module sys : passage d’arguments

Le module sys contient (comme son nom l’indique) des fonctions et des variables spéci- fiques au système, ou plus exactement à l’interpréteur lui-même. Par exemple, il permet de gérer l’entrée (stdin) et la sortie standard (stdout). Ce module est particulièrement intéressant pour récupérer les arguments passés à un script Python lorsque celui-ci est appelé en ligne

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

37

8 Modules

8.6 Module os

de commande. Dans cet exemple, oublions l’interpréteur et écrivons le script suivant que l’on enregistrera sous le nom test.py (n’oubliez pas de le rendre exécutable) :

#!/usr/bin/env python

import sys print sys.argv

Ensuite lancez test.py suivi de plusieurs arguments. Par exemple :

poulain@cumin> python test.py salut girafe 42 [‘test.py’, ‘salut’, ‘girafe’, ’42’]

Dans l’exemple précédent, poulain@cumin> représente l’invite du shell, test.py est le nom du script Python, salut, girafe et 42 sont les arguments passés au script.

La variable sys.argv est une liste qui représente tous les arguments de la ligne de com- mande, y compris le nom du script lui même qu’on peut retrouver dans sys.argv[0]. On peut donc accéder à chacun de ces arguments avec sys.argv[1], sys.argv[2]…

On peut aussi utiliser la fonction sys.exit() pour quitter un script Python. On peut don- ner comme argument un objet (en général une chaîne de caractères) qui sera renvoyé au mo- ment ou Python quittera le script. Par exemple, si vous attendez au moins un argument en ligne de commande, vous pouvez renvoyer un message pour indiquer à l’utilisateur ce que le script attend comme argument :

#!/usr/bin/env python

import sys

if len(sys.argv) != 2:

sys.exit(« ERREUR : il faut exactement un argument. »)

#

# suite du script #

Puis on l’exécute sans argument :

poulain@cumin> python test.py

ERREUR : il faut exactement un argument.

Notez qu’ici on vérifie que le script possède deux arguments car le nom du script lui-même est le premier argument et file.txt constitue le second.

8.6 Module os

Le module os gère l’interface avec le système d’exploitation.

Une fonction pratique de ce module permet de gérer la présence d’un fichier sur le disque.

>>>

>>>

>>>

import sys import os

if os.path.exists(« toto.pdb »): print « le fichier est présent »

else:

sys.exit(« le fichier est absent »)

le fichier est absent

38

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

8.7 Exercices

8 Modules

Dans cet exemple, si le fichier n’est pas présent sur le disque, on quitte le programme avec la fonction exit() du module sys.

La fonction system() permet d’appeler n’importe quelle commande externe.

>>> import os

>>> os.system(« ls -al ») total 5416

drwxr-xr-x drwxr-xr-x

-rw-r–r–

-rw-r–r–

-rw-r–r–

-rw-r–r– 0

2

6

1

1

1

1

poulain poulain poulain poulain poulain poulain

dsimb dsimb dsimb dsimb dsimb dsimb

4096

4096

124335

4706057

233585

463559

2010-07-21

2010-07-21

2010-07-21

2010-07-21

2010-07-21

2010-07-21

14:33

14:26

14:31

14:31

14:30

14:33

.

..

1BTA.pdb NC_000913.fna NC_001133.fna NC_001133.gbk

La commande externe ls -al est introduite comme une chaîne de caractères à la fonction

system().

8.7 Exercices

Conseil : pour les trois premiers exercices, utilisez l’interpréteur Python. Pour les exercices suivants, écrivez des scripts dans des fichiers, puis exécutez-les dans un shell.

1.

Affichez sur la même ligne les nombres de 10 à 20 (inclus) ainsi que leur racine carrée avec 3 décimales (module math). Exemple :

10

11

12

13

3.162

3.317

3.464

3.606

2.

3.

Calculez le cosinus de pi/2 (module math).

Affichez la liste des fichiers du répertoire courant avec le module os. N’utilisez pas la fonction os.system() mais la fonction os.listdir() (lisez la documentation pour comprendre comment l’utiliser).

Écrivez les nombres de 1 à 10 avec 1 seconde d’intervalle (module time).

Générez une séquence aléatoire de 20 chiffres, ceux-ci étant des entiers tirés entre 1 et 4 (module random).

Générez une séquence aléatoire de 20 bases de deux manières différentes (module ran- dom).

Déterminez votre jour (lundi, mardi…) de naissance (module calendar). Exercice +++. Évaluation du nombre π par la méthode Monte Carlo.

Soit un cercle de rayon 1 (en rouge) inscrit dans un carré de coté 2 (en bleu).

4.

5.

6.

7.

8.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

39

8

Modules

8.7 Exercices

L’aire du carré vaut (2R)2 soit 4. L’aire du cercle vaut πR2 soit π.

En choississant N points aléatoires (à l’aide d’une distribution uniforme) à l’intérieur du carré, la probabilité que ces points se trouvent aussi dans le cercle est

aire du cercle

π

p =

=

aire du carré 4

Soit n, le nombre points effectivement dans le cercle, il vient alors

n

N

π

p =

= ,

4

d’où

n

π = 4 × N .

Déterminez une approximation de π par cette méthode. Pour cela, vous allez, pour N ité- rations, choisir aléatoirement les coordonnées d’un point entre -1 et 1 (fonction uniform() du module random), calculer la distance entre le centre du cercle et ce point et détermi- ner si cette distance est inférieure au rayon du cercle. Le cas échéant, le compteur n sera incrémenté.

Que vaut l’approximation de π pour 100 itérations ? 500 ? 1000 ?

Conseil : pour les premiers exercices, utilisez l’interpréteur Python.

40

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

9 Plus sur les chaînes de caractères

  1. Plus sur les chaînes de caractères
    1. Préambule

Nous avons déjà abordé les chaînes de caractères dans le chapitre variables et écriture. Ici nous allons un peu plus loin notamment avec les méthodes associées aux chaînes de carac- tères. Notez qu’il existe un module string mais qui est maintenant considéré comme obsolète depuis la version 2.5 de Python.

9.2 Chaînes de caractères et listes

Les chaînes de caractères peuvent être considérées comme des listes.

>>> animaux = « girafe tigre »

>>> animaux ‘girafe tigre’

>>> len(animaux) 12

>>> animaux[3] ‘a’

Nous pouvons donc utiliser certaines propriétés des listes comme les tranches :

>>> animaux = « girafe tigre »

>>> animaux[0:4] ‘gira’

>>> animaux[9:] ‘gre’

>>> animaux[:-2] ‘girafe tig’

A contrario des listes, les chaînes de caractères présentent toutefois une différence notable, ce sont des listes non modifiables. Une fois définie, vous ne pouvez plus modifier un de ses éléments. Le cas échéant, Python renvoie un message d’erreur :

>>>

>>>

‘f’

>>>

animaux = « girafe tigre » animaux[4]

animaux[4] = « F »

Traceback (most recent call last): File « <stdin> », line 1, in <module>

TypeError: ‘str’ object does not support item assignment

Par conséquent, si vous voulez modifier une chaîne, vous êtes obligés d’en construire une nouvelle. Pour cela, n’oubliez pas que les opérateurs de concaténation (+) et de duplication (*) (cf chapitre variables et écriture) peuvent vous aider. Vous pouvez également générer une liste, qui elle est modifiable, puis revenir à une chaîne.

9.3 Caractères spéciaux

Il existe certains caractères spéciaux comme le \n que nous avons déjà vu (pour le retour à la ligne). Le \t vous permet d’écrire une tabulation. Si vous voulez écrire un guillemet simple ou double (et que celui-ci ne soit pas confondus avec les guillemets de déclaration de la chaîne de caractères), vous pouvez utiliser \’ ou \ » ou utiliser respectivement des guillements doubles ou simple pour déclarer votre chaîne de caractères.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

41

9 Plus sur les chaînes de caractères

9.4 Méthodes associées aux chaînes de caractères

>>> print « Un retour a la ligne\npuis une tabulation\t, puis un guillemet\ » » Un retour a la ligne

puis une tabulation

, puis un guillemet »

>>> print J’imprime

>>> print

‘J\’imprime un guillemet simple’ un guillemet simple

« Un brin d’ADN »

Un brin d’ADN

>>> print ‘Python est un « super » langage’ Python est un « super » langage

Lorsqu’on souhaite écrire un texte sur plusieurs lignes, il est très commode d’utiliser les guillemets triples permettant de conserver le formatage (notamment les retours à la ligne) :

>>>

>>>

x =  »’souris chat abeille »’

x

‘souris\nchat\nabeille’

>>> print x souris chat abeille

9.4 Méthodes associées aux chaînes de caractères

Voici quelques méthodes spécifiques aux objets de type string :

>>> x = « girafe »

>>> x.upper() ‘GIRAFE’

>>> x

‘girafe’

>>> ‘TIGRE’.lower()

‘tigre’

Les fonctions lower() et upper() passent un texte en minuscule et en majuscule respecti- vement. On remarque que l’utilisation de ces fonctions n’altèrent pas la chaîne de départ mais renvoie la chaîne transformée.

Pour mettre en majuscule la première lettre seulement, vous pouvez faire :

>>> x[0].upper() + x[1:] ‘Girafe’

ou encore plus simple avec la fonction Python adéquate :

>>> x.capitalize() ‘Girafe’

Il existe une méthode associée aux chaînes de caractères qui est particulièrement pratique, la fonction split() :

>>> animaux = « girafe tigre singe »

>>> animaux.split() [‘girafe’, ‘tigre’, ‘singe’]

42

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

9.4 Méthodes associées aux chaînes de caractères

9 Plus sur les chaînes de caractères

>>> for i in animaux.split():

girafe tigre singe

print i

La fonction split() découpe la ligne en champs, en utilisant comme séparateur les es- paces ou les tabulations. Il est possible de modifier le séparateur de champs, par exemple :

>>> animaux = « girafe:tigre:singe »

>>> animaux.split(« : ») [‘girafe’, ‘tigre’, ‘singe’]

La fonction find() recherche une chaîne de caractères passée en argument.

>>>

>>> 1

>>> 3

>>>

-1

animal = « girafe » animal.find(‘i’)

animal.find(‘afe’)

animal.find(‘tig’)

Si l’élément recherché est trouvé, alors l’indice du début de l’élément dans la chaîne de caractères est renvoyé. Si l’élément n’est pas trouvé, alors la valeur -1 est renvoyée.

Si l’élément recherché est trouvé plusieurs fois, seul l’indice de la première occurence est retourné :

>>> animaux = « girafe tigre »

>>> animaux.find(« i ») 1

On trouve aussi la fonction replace(), qui serait l’équivalent de la fonction de substitu- tion de la commande Unix sed :

>>> animaux = « girafe tigre »

>>> animaux.replace(« tigre », « singe ») ‘girafe singe’

>>> animaux.replace(« i », « o ») ‘gorafe togre’

Enfin, la fonction count() compte le nombre d’occurences d’une chaîne de caractères pas- sée en argument :

>>>

>>> 2

>>> 0

>>> 1

animaux = « girafe tigre » animaux.count(« i »)

animaux.count(« z »)

animaux.count(« tigre »)

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

43

9 Plus sur les chaînes de caractères

9.5 Conversion de types

9.5 Conversion de types

Dans tout langage de programmation, on est souvent amené à convertir les types, c’est-à- dire passer d’un type numérique à une chaîne de caractères ou vice-versa. En Python, rien de plus simple avec les fonctions int(), float() et str(). Pour vous en convaincre, regardez ces exemples :

>>>

>>> ‘3’

>>>

>>> 456

>>>

i = 3 str(i)

i = ‘456’

int(i)

float(i)

456.0

>>> i = ‘3.1416’

>>> float(i) 3.1415999999999999

Ces conversions sont essentielles lorsqu’on lit ou écrit des nombres dans un fichier. En effet, les nombres dans un fichier sont considérés comme du texte par la fonction readlines(), par conséquent il faut les convertir si on veut effectuer des opérations numériques dessus.

9.6 Conversion d’une liste de chaînes de caractères en une chaîne de caractères

La conversion d’une liste de chaînes de caractères en une chaîne de caractères est un peu particulière puisqu’elle fait appelle à la fonction join().

>>> seq = [« A », « T », « G », « A », « T »]

>>> seq

[‘A’, ‘T’, ‘G’, ‘A’, ‘T’]

>>> « -« .join(seq)

‘A-T-G-A-T’

>>>  » « .join(seq) ‘A T G A T’

>>> «  ».join(seq) ‘ATGAT’

Les éléments de la liste initiale sont concaténés les uns à la suite des autres et intercalés par un séparateur qui peut être n’importe quelle chaîne de caractères (ici, nous avons utilisé un tiret, un espace et rien).

Attention, la fonction join() ne s’applique qu’à une liste de chaînes de caractères.

>>> maliste = [« A », 5,

>>>  » « .join(maliste) Traceback (most recent

File « <stdin> », line

« G »]

call last):

1, in <module>

TypeError: sequence item 1: expected string, int found

Nous espérons qu’après ce petit tour d’horizon vous serez convaincu de la richesse des méthodes associées aux chaînes de caractères. Pour avoir une liste exhaustive de l’ensemble des méthodes associées à une variable particulière, vous pouvez utiliser la commande dir().

44

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

9.7 Exercices

9 Plus sur les chaînes de caractères

>>> dir(animaux)

[‘ add ‘, ‘ class ‘, ‘ contains ‘, ‘ delattr ‘, ‘ doc ‘, ‘ eq ‘, ‘

‘ getattribute ‘, ‘ getitem ‘, ‘ getnewargs ‘, ‘ getslice ‘, ‘ gt ‘,

‘ hash ‘, ‘ init ‘, ‘ le ‘, ‘ len ‘, ‘ lt ‘, ‘ mod ‘, ‘ mul ‘, ‘

‘ new ‘, ‘ reduce ‘, ‘ reduce_ex ‘, ‘ repr ‘, ‘ rmod ‘, ‘ rmul ‘, ‘ setattr ‘, ‘ str ‘, ‘capitalize’, ‘center’, ‘count’, ‘decode’, ‘encode’,

‘endswith’, ‘expandtabs’, ‘find’, ‘index’, ‘isalnum’, ‘isalpha’, ‘isdigit’, ‘isl

‘isspace’, ‘istitle’, ‘isupper’, ‘join’, ‘ljust’, ‘lower’, ‘lstrip’, ‘partition’

‘replace’, ‘rfind’, ‘rindex’, ‘rjust’, ‘rpartition’, ‘rsplit’, ‘rstrip’, ‘split’

‘splitlines’, ‘startswith’, ‘strip’, ‘swapcase’, ‘title’, ‘translate’, ‘zfill’]

Pour l’instant vous pouvez ignorer les méthodes qui commencent et qui se terminent par deux tirets bas (underscores) « ».

Vous pouvez ensuite accéder à l’aide et à la documentation d’une fonction particulière avec

help() :

>>> help(animaux.split)

Help on built-in function split:

‘upper’,

split(…)

S.split([sep [,maxsplit]]) -> list of strings

Return a list of the words in the string

S,

at or

using sep as the most maxsplit is None, any

delimiter string.

If maxsplit is given,

splits are done. If sep is not specified whitespace string is a separator.

(END)

9.7 Exercices

Conseil : pour ces exercices, écrivez des scripts dans des fichiers, puis exécutez-les dans un

shell.

1.

Soit la liste [‘girafe’, ‘tigre’, ‘singe’, ‘souris’]. Avec une boucle, affichez chaque élément ainsi que sa taille (nombre de caractères).

Soit la séquence nucléique ATATACGGATCGGCTGTTGCCTGCGTAGTAGCGT. Calculez la fré- quence de chaque base dans cette séquence.

2.

3.

Soit la séquence protéique ALA GLY GLU ARG TRP TYR

SER GLY ALA TRP. Trans-

formez cette séquence en une chaîne de caractères en utilisant le code une lettre pour les acides aminés.

Distance de Hamming.

La distance de Hamming mesure la différence entre deux séquences de même taille en sommant le nombre de positions qui, pour chaque séquence, ne correspondent pas au

4.

même acide aminé. Calculez la distance de Hamming pour les séquences AGWPSGGASAGLAIL

et IGWPSAGASAGLWIL.

Palindrome.

Un palindrome est un mot ou une phrase dont l’ordre des lettres reste le même si on le lit de gauche à droite ou de droite à gauche. Par exemple, « ressasser » et « Engage le jeu que je le gagne » sont des palindromes.

Écrivez un script qui détermine si une chaîne de caractères est un palindrome. Pensez à vous débarasser des majuscules et des espaces. Testez si les expressions suivantes sont des palindromes : « Radar », « Never odd or even », « Karine alla en Iran », « Un roc si biscornu ».

5.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

45

9

Plus sur les chaînes de caractères

9.7 Exercices

6.

Mot composable.

Un mot est composable à partir d’une séquence de lettres si la séquence contient toutes les lettres du mot. Comme au Scrabble, chaque lettre de la séquence ne peut être utilisée qu’une seule fois. Par exemple, coucou est composable à partir de uocuoceokzefhu.

Écrivez un script qui permet de savoir si un mot est composable à partir d’une séquence de lettres. Testez le avec différents mots et séquences.

Remarque : dans votre script, le mot et la séquence de lettres seront des chaînes de carac- tères.

Alphabet et pangramme.

Les codes ASCII des lettres minuscules de l’alphabet vont de 97 (lettre a) à 122 (lettre z). La fonction chr() prend en argument un code ASCII sous forme d’une entier et renvoie le caractère correspondant. Ainsi chr(97) renvoie ‘a’, chr(98) renvoie ‘b’ et ainsi de suite.

Écrivez un script qui construit une chaîne de caractères contenant toutes les lettres de l’alphabet.

Un pangramme est une phrase comportant au moins une fois chaque lettre de l’alphabet. Par exemple, « Portez ce vieux whisky au juge blond qui fume » est un pangramme.

Modifiez le script précédent pour déterminer si une chaîne de caractères est un pan- gramme ou non. Pensez à vous débarasser des majuscules le cas échéant. Testez si les expressions suivantes sont des pangrammes : « Monsieur Jack vous dactylographiez bien mieux que votre ami Wolf », « Buvez de ce whisky que le patron juge fameux ».

Téléchargez le fichier pdb 1BTA dans votre répertoire. Faites un script qui récupère seule- ment les carbones alpha et qui les affiche à l’écran.

En vous basant sur le script précédent, affichez à l’écran les carbones alpha des deux premiers résidus. Toujours avec le même script, calculez la distance inter atomique entre ces deux atomes.

En vous basant sur le script précédent, calculez les distances entre carbones alpha consé- cutifs. Affichez ces distances sous la forme

numero_calpha_1 numero_calpha_2 distance

À la fin du script, faites également afficher la moyenne des distances. La distance inter carbone alpha dans les protéines est très stable et de l’ordre de 3,8 angströms. Observez avec attention les valeurs que vous avez obtenues. Expliquez l’anomalie détectée.

7.

8.

9.

10.

46

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

10 Plus sur les listes

  1. Plus sur les listes
    1. Propriétés des listes

Jusqu’à maintenant, nous avons toujours utilisé des listes qui étaient déjà remplies. Nous savons comment modifier un de ses éléments, mais il est aussi parfois très pratique d’en re- manier la taille (e. g. ajouter, insérer ou supprimer un ou plusieurs éléments, etc.). Les listes possèdent à cet effet des méthodes qui leurs sont propres. Observez les exemples suivants :

append() pour ajouter un élément à la fin d’une liste.

>>>

>>>

>>> [1,

x = [1,2,3]

x.append(5) x

2, 3, 5]

qui est équivalent à

>>>

>>>

>>> [1,

x = [1,2,3] x = x + [5]

x

2, 3, 5]

insert() pour insèrer un object dans une liste avec un indice déterminé.

>>>

>>> [1,

x.insert(2,-15) x

2, -15, 3, 5]

del pour supprimer un élément d’une liste à une indice déterminé.

>>>

>>> [1,

del x[1] x

-15, 3, 5]

remove() pour supprimer un élément d’une liste à partir de sa valeur

>>>

>>> [1,

x.remove(5) x

-15, 3]

sort() pour trier une liste.

>>> x.sort()

>>> x

[-15, 1, 3]

reverse() pour inverser une liste.

>>>

>>> [3,

x.reverse() x

1, -15]

count() pour compter le nombre d’éléments (passé en argument) dans une liste.

>>>

>>> 3

>>> 1

>>> 0

l=[1, 2, 4, 3, 1, 1]

l.count(1)

l.count(4)

l.count(23)

Remarque 1 : attention, une liste remaniée n’est pas renvoyée ! Pensez-y dans vos utilisa- tions futures des listes.

Remarque 2 : attention, certaines fonctions ci-dessus décalent les indices d’une liste (par exemple insert(), del etc).

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

47

10 Plus sur les listes

10.2 Test d’appartenance

La méthode append() est particulièrement pratique car elle permet de construire une liste au fur et à mesure des itérations d’une boucle. Pour cela, il est commode de définir préalable- ment une liste vide de la forme maliste = []. Voici un exemple où une chaîne de caractères est convertie en liste :

>>>

>>>

>>> []

>>>

>>>

seq = ‘CAAAGGTAACGC’

seq_list = [] seq_list

for i in seq: seq_list.append(i)

seq_list

[‘C’, ‘A’, ‘A’, ‘A’, ‘G’, ‘G’, ‘T’, ‘A’, ‘A’, ‘C’, ‘G’, ‘C’]

Remarquez que vous pouvez directement utiliser la fonction list() qui prend n’importe quel objet séquentiel (liste, chaîne de caractères, tuples, etc.) et qui renvoie une liste :

>>> seq = ‘CAAAGGTAACGC’

>>> list(seq)

[‘C’, ‘A’, ‘A’, ‘A’, ‘G’, ‘G’, ‘T’, ‘A’, ‘A’, ‘C’, ‘G’, ‘C’]

Cette méthode est certes plus simple, mais il arrive parfois que l’on doive utiliser les boucles tout de même, comme lorqu’on lit un fichier.

10.2 Test d’appartenance

L’inscription in permet de tester si un élément fait partie d’une liste.

liste

>>> 3

True

>>> 4

False

>>> 3

False

>>> 4

True

= [1, 3, 5, 7, 9]

in liste

in liste

not in liste

not in liste

La variation avec not permet, a contrario, de vérifier qu’un élement n’est pas dans une liste.

10.3 Copie de listes

Il est très important de savoir que l’affectation d’une liste (à partir d’une liste préexistante) crée en réalité une référence et non une copie :

>>>

>>>

>>> [1,

>>>

>>> [1,

x = [1,2,3]

y = x y

2, 3]

x[1]

y

-15,

= -15

3]

48

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

10.3 Copie de listes

10 Plus sur les listes

Vous voyez que la modification de x modifie y aussi. Rappelez-vous de ceci dans vos futurs programmes car cela pourrait avoir des effets désastreux ! Techniquement, Python utilise des pointeurs (comme dans le langage C) vers les mêmes objets et ne crée pas de copie à moins que vous n’en ayez fait la demande explicitement. Regardez cet exemple :

>>>

>>>

>>>

>>> [1,

x = [1,2,3]

y = x[:]

x[1] = -15

y

2, 3]

Dans l’exemple précédent, x[:] a créé une copie « à la volée » de la liste x. Vous pouvez utiliser aussi la fonction list() qui renvoie explicitement une liste :

>>>

>>>

>>>

>>> [1,

x = [1,2,3]

y = list(x) x[1] = -15

y

2, 3]

Attention, les deux techniques précédentes ne fonctionnent que pour les listes à une dimen- sion, autrement dit les listes qui ne contienent pas elles-mêmes d’autres listes.

>>>

>>>

x = [[1,2],[3,4]]

x

[[1, 2], [3, 4]]

>>>

>>>

>>>

y = x[:]

y[1][1] = 55

y

[[1, 2], [3, 55]]

>>>

x

[[1, 2], [3, 55]]

>>>

>>>

>>>

y = list(x) y[1][1] = 77

y

[[1, 2], [3, 77]]

>>>

x

[[1, 2], [3, 77]]

La méthode de copie qui marche à tous les coups consiste à appeler la fonction deepcopy()

du module copy.

>>>

>>>

>>>

import copy

x = [[1,2],[3,4]]

x

[[1, 2], [3, 4]]

>>>

>>>

>>>

y = copy.deepcopy(x) y[1][1] = 99

y

[[1, 2], [3, 99]]

>>>

x

[[1, 2], [3, 4]]

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

49

10 Plus sur les listes

10.4 Exercices

10.4 Exercices

Conseil : pour ces exercices, écrivez des scripts dans des fichiers, puis exécutez-les dans un

shell.

1.

Soit la liste de nombres [8, 3, 12.5, 45, 25.5, 52, 1]. Triez les nombres de cette liste par ordre croissant, sans utiliser la fonction sort() (les fonctions min(), append() et remove() vous seront utiles).

Générez aléatoirement une séquence nucléique de 20 bases en utilisant une liste et la méthode append().

Transformez la séquence nucléique TCTGTTAACCATCCACTTCG en sa séquence complé- mentaire inverse. N’oubliez pas que la séquence complémentaire doit être inversée, pen- sez aux méthodes des listes !

2.

3.

4.

Soit la liste de nombres [5, 1, 1, 2, 5,

blons de cette liste, triez-là et affichez-là.

6, 3, 4, 4, 4, 2]. Enlevez les dou-

5.

Générez aléatoirement une séquence nucléique de 50 bases contenant 10 % de A, 50 % de G, 30 % de T et 10 % de C.

Exercice +++. Triangle de Pascal

Voici le début du triangle de Pascal :

1

11

121

1331

14641

Comprenez comment une ligne est construite à partir de la précente. À partir de l’ordre 1 (ligne 2, 11), générez l’ordre suivant (121). Vous pouvez utiliser une liste préalable- ment générée avec range(). Généralisez à l’aide d’une boucle. Écrivez dans un fichier pascal.out les lignes du triangle de Pascal de l’ordre 1 jusqu’à l’ordre 10.

6.

50

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

11 Dictionnaires et tuples

  1. Dictionnaires et tuples
    1. Dictionnaires

Les dictionnaires se révèlent très pratiques lorsque vous devez manipuler des structures complexes à décrire et que les listes présentent leurs limites. Les dictionnaires sont des col- lections non ordonnées d’objets, c-à-d qu’il n’y a pas de notion d’ordre (i. e. pas d’indice). On accède aux valeurs d’un dictionnaire par des clés. Ceci semble un peu confus ? Regardez l’exemple suivant :

>>>

>>>

>>>

>>>

>>>

ani1 = {}

ani1[‘nom’] = ‘girafe’ ani1[‘taille’] = 5.0

ani1[‘poids’] = 1100 ani1

{‘nom’: ‘girafe’, ‘poids’: 1100, ‘taille’: 5.0}

>>> ani1[‘taille’] 5.0

En premier, on définit un dictionnaire vide avec les symboles {} (tout comme on peut le faire pour les listes avec []). Ensuite, on remplit le dictionnaire avec différentes clés auxquelles on affecte des valeurs (une par clé). Vous pouvez mettre autant de clés que vous voulez dans un dictionnaire (tout comme vous pouvez ajouter autant d’éléments que vous voulez dans une liste). Pour récupérer la valeur d’une clé donnée, il suffit d’utiliser une syntaxe du style dictionnaire[‘cle’].

Méthodes keys() et values()

Les méthodes keys() et values() renvoient, comme vous vous en doutez, les clés et les valeurs d’un dictionnaire (sous forme de liste) :

>>> ani1.keys()

[‘nom’, ‘poids’, ‘taille’]

>>> ani1.values() [‘girafe’, 1100, 5.0]

On peut aussi initialiser toutes les clés d’un dictionnaire en une seule opération :

>>> ani2 = {‘nom’:’singe’, ‘poids’:70, ‘taille’:1.75}

Liste de dictionnaires

En créant une liste de dictionnaires possédant les mêmes clés, on obtient une structure qui ressemble à une base de données :

>>> animaux = [ani1, ani2]

>>> animaux

[{‘nom’: ‘girafe’, ‘poids’: 1100, ‘taille’: 5.0}, {‘nom’: ‘singe’, ‘poids’:

>>>

>>> for ani in animaux:

70,

girafe singe

print ani[‘nom’]

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

51

11 Dictionnaires et tuples

11.2 Tuples

Existence d’une clef

Enfin, pour vérifier si une clé existe, vous pouvez utiliser la propriété has_key() :

>>> if ani2.has_key(‘poids’):

print « La clef ‘poids’ existe pour ani2 »

La clef ‘poids’ existe pour ani2

Python permet même de simplifier encore les choses :

>>> if « poids » in ani2:

print « La clef ‘poids’ existe pour ani2 »

La clef ‘poids’ existe pour ani2

Vous voyez que les dictionnaires permettent de gérer des structures complexes de manière plus explicite que les listes.

11.2 Tuples

Les tuples correspondent aux listes à la différence qu’ils sont non modifiables. On a vu à la section précédente que les listes pouvaient être modifiées par des références ; les tuples vous permettent de vous affranchir de ce problème. Pratiquement, ils utilisent les parenthèses au lieu des crochets :

>>>

>>> (1,

>>> 3

>>> (1,

>>>

x = (1,2,3)

x

2, 3)

x[2]

x[0:2] 2)

x[2] = 15

Traceback (innermost last): File « <stdin> », line 1, in ?

TypeError: object doesn’t support item assignment

L’affectation et l’indiçage fonctionne comme avec les listes, mais si l’on essaie de modifier un des éléments du tuple, Python renvoie un message d’erreur. Si vous voulez ajouter un élément (ou le modifier), vous devez créer un autre tuple :

>>>

>>> (1,

x = (1,2,3)

x + (2,)

2, 3, 2)

Remarquez que pour utiliser un tuple d’un seul élément, vous devez utiliser une syntaxe avec une virgule (element,), ceci pour éviter une ambiguïté avec une simple expression. Autre particularité des tuples, il est possible d’en créer de nouveaux sans les parenthèses, dès lors que ceci ne pose pas d’ambiguïté avec une autre expression :

>>>

>>> (1,

>>>

>>> (1,

x = (1,2,3)

x

2, 3)

x = 1,2,3

x

2, 3)

52

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

11.3 Exercices

11 Dictionnaires et tuples

Toutefois, nous vous conseillons d’utiliser systématiquement les parenthèses afin d’éviter les confusions.

Enfin, on peut utiliser la fonction tuple(sequence) qui fonctionne exactement comme la fonction list, c-à-d qu’elle prend en argument un objet séquentiel et renvoie le tuple corres- pondant :

>>> [0,

>>> (0,

>>>

range(10)

1, 2, 3, 4, 5, 6, 7, 8, 9]

tuple(range(10))

1, 2, 3, 4, 5, 6, 7, 8, 9) tuple(« ATGCCGCGAT »)

(‘A’, ‘T’, ‘G’, ‘C’, ‘C’, ‘G’, ‘C’, ‘G’, ‘A’, ‘T’)

Remarque : les listes, dictionnaires, tuples sont des objets qui peuvent contenir des collec- tions d’autres objets. On peut donc construire des listes qui contiennent des dictionnaires, des tuples ou d’autres listes, mais aussi des dictionnaires contenant des tuples, des listes, etc.

11.3 Exercices

Conseil : pour ces exercices, écrivez des scripts dans des fichiers, puis exécutez-les dans un

shell.

1.

En utilisant un dictionnaire et la fonction has_key(), déterminez le nombre d’occu- rences de chaque acide aminé dans la séquence AGWPSGGASAGLAILWGASAIMPGALW. Le dictionnaire ne doit contenir que les acides aminés présents dans la séquence.

Soit la séquence nucléotidique suivante :

ACCTAGCCATGTAGAATCGCCTAGGCTTTAGCTAGCTCTAGCTAGCTG

En utilisant un dictionnaire, faites un programme qui répertorie tous les mots de 2 lettres qui existent dans la sequence (AA, AC, AG, AT, etc.) ainsi que leur nombre d’occurences puis qui les affiche à l’écran.

Faites de même avec des mots de 3 et 4 lettres.

En vous basant sur les scripts précédents, extrayez les mots de 2 lettres et leur occu- rence sur le génome du chromosome I de la levure du boulanger Saccharomyces cerevisiae NC_001133.fna. Attention, le génome complet est fourni au format fasta.

Créez un script extract-words.py qui prend en arguments un fichier genbank suivi d’un entier compris entre 1 et 4. Ce script doit extraire du fichier genbank tous les mots (ainsi que leur nombre d’occurences) du nombre de lettres passées en option.

Appliquez ce script sur le génome d’Escherichia coli : NC_000913.fna (au format fasta). Cette méthode vous paraît-elle efficace sur un génome assez gros comme celui d’E. Coli ? Comment pourrait-on en améliorer la rapidité ?

À partir du fichier PDB 1BTA, construisez un dictionnaire qui contient 4 clés se référant au premier carbone alpha : le numéro du résidu, puis les coordonnées x, y et z.

Sur le même modèle que ci-dessus, créez une liste de dictionnaires pour chacun des car- bones alpha de la protéine.

À l’aide de cette liste, calculez les coordonnées x, y et z du barycentre de ces carbones alpha.

2.

3.

4.

5.

6.

7.

8.

9.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

53

12 Fonctions

  1. Fonctions
    1. Principe

En programmation, les fonctions sont très utiles pour réaliser plusieurs fois la même opéra- tion au sein d’un programme. Elles permettent également de rendre le code plus lisible et plus clair en le fractionnant en blocs logiques.

Vous connaissez déjà certaines fonctions Python, par exemple math.cos(angle) du mo- dule math renvoie le cosinus de la variable angle exprimée en radian. Vous connaissez aussi des fonctions internes à Python comme range() ou len(). Pour l’instant, une fonction est à vos yeux une sorte de « boîte noire » :

À laquelle vous passez une (ou zero ou plusieurs) valeur(s) entre parenthèses. Ces valeurs sont appelées arguments.

Qui effectue une action. Par exemple random.shuffle() permute aléatoirement une liste.

Et qui renvoie éventuellement un résultat.

Par exemple si vous appelez la fonction range() en lui passant la valeur 5 (range(5)), celle- ci vous renvoie une liste de nombres entiers de 0 à 4 ([0, 1, 2, 3, 4]).

Au contraire, aux yeux du programmeur une fonction est une portion de code effectuant une action bien particulière. Avant de démarrer sur la syntaxe, revenons sur cette notion de

« boîte noire » :

1.

Une fonction effectue une tâche. Pour cela, elle reçoit éventuellement des arguments et renvoie éventuellement un résultat. Ce qui se passe en son sein n’intéresse pas directe- ment l’utilisateur. Par exemple, il est inutile de savoir comment la fonction math.cos() calcule un cosinus, on a juste besoin de savoir qu’il faut lui passer en argument un angle en radian et qu’elle renvoie le cosinus de cet angle. Ce qui se passe au sein de la fonction ne regarde que le programmeur (c’est-à-dire vous dans ce chapitre).

Chaque fonction effectue en général une tâche unique et précise. Si cela se complique, il est plus judicieux d’écrire plusieurs fonctions (qui peuvent éventuellement s’appeler les unes les autres). Cette modularité améliore la qualité générale et la lisibilité du code. Vous verrez qu’en Python, les fonctions présentent une grande flexibilité.

2.

12.2 Définition

Pour définir une fonction, Python utilise le mot-clé def et si on veut que celle-ci renvoie une valeur, il faut utiliser le mot-clé return. Par exemple :

>>>

>>> 4

def carre(x):

return x**2

print carre(2)

Remarquez que la syntaxe de def utilise les : comme les boucles for, while ainsi que les tests if, un bloc d’instrutions est donc attendu. De même que pour les boucles et les tests, l’indentation de ce bloc d’instructions (i.e. le corps de la fonction) est obligatoire.

Dans l’exemple précédent, nous avons passé un argument à la fonction carre() qui nous a retourné une valeur que nous avons affichée à l’écran. Que veut dire valeur retournée ? Et bien cela signifie que cette dernière est stockable dans une variable :

54

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

12.3

Passage d’arguments

12 Fonctions

>>>

>>> 4

res = carre(2) print res

Ici, le résultat renvoyé par la fonction est stockée dans la variable res. Notez qu’une fonc- tion ne prend pas forcément un argument et ne renvoie pas forcément une valeur, par exemple :

>>>

>>>

def hello():

print « bonjour »

hello()

bonjour

Dans ce cas la fonction hello() se contente d’imprimer la chaîne de caractères « hello » à l’écran. Elle ne prend aucun argument et ne renvoie aucun résultat. Par conséquent, cela n’a pas de sens de vouloir récupérer dans une variable le résultat renvoyé par une telle fonction . Si on essaie tout de même, Python affecte la valeur None qui signifie « rien » en anglais :

>>> x = hello() bonjour

>>> print x None

12.3 Passage d’arguments

Le nombre d’argument(s) que l’on peut passer à une fonction est variable. Nous avons vu ci-dessus des fonctions auxquelles on passait 0 ou 1 argument. Dans les chapitres précédentes, vous avez vu des fonctions internes à Python qui prenaient au moins 2 arguments, pour rappel souvenez-vous de range(1,10) ou encore range(1,10,2). Le nombre d’argument est donc laissé libre à l’initiative du programmeur qui est en train de développer une nouvelle fonction. Une particularité des fonctions en Python est que vous n’êtes pas obligé de préciser le type des arguments que vous lui passez, dès lors que les opérations que vous effectuez avec ces arguments sont valides. Python est en effet connu comme étant un langage au typage dyna- mique, c’est-à-dire qu’il reconnaît pour vous le type des variables au moment de l’exécution,

par exemple :

>>>

>>> 6

>>>

def fois(x,y): return x*y

fois(2,3)

fois(3.1415,5.23)

16.430045000000003

>>> fois(‘to’,2) ‘toto’

L’opérateur * reconnait plusieurs types (entiers, réels, chaînes de caractères), notre fonction est donc capable d’effectuer plusieurs tâches !

Un autre gros avantage de Python est que ses fonctions sont capables de renvoyer plusieurs valeurs à la fois, comme dans cette fraction de code :

>>> def carre_cube(x):

return x**2,x**3

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

55

12 Fonctions

12.4 Portée des variables

>>> carre_cube(2) (4, 8)

Vous voyez qu’en réalité Python renvoie un objet séquentiel qui peut par conséquent conte- nir plusieurs valeurs. Dans notre exemple Python renvoie un objet tuple car on a utilisé une syntaxe de ce type. Notre fonction pourrait tout autant renvoyer une liste :

>>>

>>> [9,

def carre_cube2(x): return [x**2,x**3]

carre_cube2(3) 27]

Enfin, il est possible de passer un ou plusieurs argument(s) de manière facultative et de leur attribuer une valeur par défaut :

>>>

>>> 1

>>> 10

def useless_fct(x=1): return x

useless_fct()

useless_fct(10)

Notez que si on passe plusieurs arguments à une fonction, le ou les arguments facultatifs doivent être situés après les arguments obligatoires. Il faut donc écrire def fct(x, y, z=1):.

12.4 Portée des variables

Il est très important lorsque l’on manipule des fonctions de connaître la portée des variables. Premièrement, on peut créer des variables au sein d’une fonction qui ne seront pas visibles à l’extérieur de celle-ci ; on les appelle variables locales. Observez le code suivant :

>>>

>>>

def

mafonction():

x = 2

print ‘x vaut’,x,’dans la fonction’

mafonction()

x vaut 2 dans la fonction

>>> print x

Traceback (most recent File « <stdin> », line NameError: name ‘x’ is

call last): 1, in ? not defined

Lorsque Python exécute le code de la fonction, il connait le contenu de la variable x. Par contre, de retour dans le module principal (dans notre cas, il s’agit de l’interpréteur Python), il ne la connaît plus d’où le message d’erreur. De même, une variable passée en argument est considé- rée comme locale lorsqu’on arrive dans la fonction :

>>>

>>>

def mafonction(x):

print ‘x vaut’,x,’dans la fonction’

mafonction(2)

x vaut 2 dans la fonction

56

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

12.5 Portée des listes

12 Fonctions

>>> print x

Traceback (most recent File « <stdin> », line NameError: name ‘x’ is

call last): 1, in ? not defined

Deuxièmement, lorsqu’une variable déclarée à la racine du module (c’est comme cela que l’on appelle un programme Python), elle est visible dans tout le module.

>>>

>>>

>>> 3

>>> 3

def

mafonction(): print x

x =

3

mafonction()

print x

Dans ce cas, la variable x est visible dans le module principal et dans toutes les fonctions du module. Toutefois, Python ne permet pas la modification d’une variable globale dans une fonc- tion :

>>>

>>>

>>>

def mafonction(): x = x + 1

x=1 mafonction()

Traceback (most recent File « <stdin> », line File « <stdin> », line

call last):

1, in <module>

2, in fct

UnboundLocalError: local variable ‘x’ referenced before assignment

L’erreur renvoyée montre que Python pense que x est une variable locale qui n’a pas été encore assignée. Si on veut vraiment modifier une variable globale dans une fonction, il faut utiliser le mot-clé global :

>>>

>>>

>>>

>>> 2

def

mafonction(): global x

x = x + 1

x=1 mafonction() x

Dans ce dernier cas, le mot-clé global a forcé la variable x a être globale plutôt que locale au sein de la fonction.

12.5 Portée des listes

Soyez extrêmement attentifs avec les types modifiables (tels que les listes) car vous pouvez les changer au sein d’une fonction :

>>> def mafonction():

liste[1] = -127

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

57

12 Fonctions

12.6 Règle LGI

>>>

>>>

>>> [1,

liste = [1,2,3] mafonction() liste

-127, 3]

De même que si vous passez une liste en argument, elle est tout autant modifiable au sein de la fonction :

>>>

>>>

>>>

>>> [1,

def

mafonction(x): x[1] = -15

y =

[1,2,3]

mafonction(y) y

-15, 3]

Si vous voulez éviter ce problème, utilisez des tuples, Python renverra une erreur puisque ces derniers sont non modifiables ! Une autre solution pour éviter la modification d’une liste lorsqu’elle est passée en tant qu’argument, est de la passer explicitement (comme nous l’avons fait pour l’affectation) afin qu’elle reste intacte dans le programme principal.

>>>

>>>

>>>

>>> [1,

>>>

>>> [1,

def

mafonction(x): x[1] = -15

y =

[1,2,3]

mafonction(y[:]) y

2, 3]

mafonction(list(y)) y

2, 3]

Dans ces deux derniers exemples, une copie de y est créée à la volée lorsqu’on appelle la fonc- tion, ainsi la liste y du module principal reste intacte.

12.6 Règle LGI

Lorsque Python rencontre une variable, il va traiter la résolution de son nom avec des prio- rités particulières : d’abord il va regarder si la variable est locale, puis si elle n’existe pas loca- lement, il vérifiera si elle est globale et enfin si elle n’est pas globale, il testera si elle est interne (par exemple la fonction len() est considérée comme une fonction interne à Python, i.e. elle existe à chaque fois que vous lancez Python). On appelle cette règle la règle LGI pour locale, globale, interne. En voici un exemple :

>>>

>>>

>>>

def

mafonction():

x = 4

print ‘Dans la fonction x vaut’, x

x =

-15

mafonction()

Dans la fonction x vaut

4

>>> print ‘Dans le module principal x vaut’,x Dans le module principal x vaut -15

58

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

12.7 Exercices

12 Fonctions

Vous voyez que dans la fonction, x a pris la valeur qui lui était définie localement en priorité sur sa valeur définie dans le module principal.

Conseil : même si Python peut reconnaître une variable ayant le même nom que ses fonctions ou variables internes, évitez de les utiliser car ceci rendra votre code confus !

12.7 Exercices

Conseil : pour ces exercices, écrivez des scripts dans des fichiers, puis exécutez-les dans un

shell.

1.

Prédisez le comportement de ce code sans le recopier dans un script ni dans l’interpréteur Python :

def hello(prenom):

print « Bonjour », prenom

hello(« Patrick ») print x

Prédisez le comportement de ce code sans le recopier dans un script ni dans l’interpréteur Python :

x = 10

2.

def hello(prenom):

print « Bonjour », prenom

hello(« Patrick ») print x

Prédisez le comportement de ce code sans le recopier dans un script ni dans l’interpréteur Python :

x = 10

3.

def hello(prenom):

print « Bonjour », prenom print x

hello(« Patrick ») print x

Prédisez le comportement de ce code sans le recopier dans un script ni dans l’interpréteur Python :

x = 10

4.

def hello(prenom): x = 42

print « Bonjour », prenom print x

hello(« Patrick ») print x

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

59

12 Fonctions

12.7 Exercices

5.

Créez une fonction qui prend une liste de bases et qui renvoie la séquence complémen- taire d’une séquence d’ADN sous forme de liste.

À partir d’une séquence d’ADN ATCGATCGATCGCTGCTAGC, renvoyez le brin complé- mentaire (n’oubliez pas que la séquence doit être inversée).

Créez une fonction distance() qui calcule une distance euclidienne en 3 dimensions entre deux atomes. En reprenant l’exercice sur le calcul de la distance entre carbones alpha consécutifs de la protéine 1BTA (chapitre sur les chaînes de caractères), refaites la même chose en utilisant votre fonction distance().

6.

7.

60

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

13 Expressions régulières et parsing

13

Expressions régulières et parsing

Le module re vous permet d’utiliser des expressions régulières au sein de Python. Les ex- pressions régulières sont aussi appelées en anglais regular expressions ou regex. Elles sont incon- tournables en bioinformatique lorsque vous voulez récupérer des informations dans un fichier.

Cette action de recherche de données dans un fichier est appelée plus généralement parsing (qui signifie littéralement « analyse syntaxique » en anglais). Le parsing fait partie du travail quotidien du bioinformaticien, il est sans arrêt en train de « fouiller » dans des fichiers pour en extraire des informations d’intérêt comme par exemple récupérer les coordonnées 3D des atomes d’une protéines dans un fichier PDB ou alors extraire les gènes d’un fichier genbank.

Dans ce chapitre, nous ne ferons que quelques rappels sur les expressions régulières. Pour un documentation plus complète, référez-vous à la page d’aide des expressions régulières sur le site officiel de Python.

13.1 Définition et syntaxe

Une expression régulière est une suite de caractères qui a pour but de décrire un fragment de texte. Elle est constitué de deux types de caractères :

1.

Les caractères dits normaux.

2.

Les métacaractères ayant une signification particulière, par exemple ^ signifie début de ligne et non pas le caractère « chapeau » littéral.

Certains programmes Unix comme egrep, sed ou encore awk savent interpréter les expres- sions régulières. Tous ces programmes fonctionnent généralement selon le schéma suivant :

1.

Le programme lit un fichier ligne par ligne.

2.

Pour chaque ligne lue, si l’expression régulière passée en argument est présente alors le programme effectue une action.

Par exemple, pour le programme egrep :

[fuchs@rome DEFINITION

[fuchs@rome

cours_python]$ egrep « ^DEF » herp_virus.gbk Human herpesvirus 2, complete genome. cours_python]$

Ici, egrep renvoie toutes les lignes du fichier genbank du virus de l’herpès (herp_virus.gbk) qui correspondent à l’expression régulière ^DEF (i.e. DEF en début de ligne).

Avant de voir comment Python gère les expressions régulières, voici quelques éléments de syntaxe des métacaractères :

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

61

13 Expressions régulières et parsing

13.2 Module re et fonction search

début de chaîne de caractères ou de ligne

Exemple : l’expression ^ATG correspond à la chaîne de caractères ATGCGT

mais pas à la chaîne CCATGTT.

fin de chaîne de caractères ou de ligne

^

$

Exemple : l’expression ATG$ correspond à la chaîne de caractères TGCATG

mais pas avec la chaîne CCATGTT.

n’importe quel caractère (mais un caractère quand même)

.

Exemple : l’expression A.G correspond à ATG, AtG, A4G, mais aussi à A-G ou à A G.

le caractère A ou B ou C (un seul caractère)

[ABC]

Exemple : l’expression T[ABC]G correspond à TAG, TBG ou TCG, mais pas à

TG.

n’importe quelle lettre majuscule

[A-Z]

Exemple : l’expression C[A-Z]T correspond à CAT, CBT, CCT… n’importe quelle lettre minuscule

[a-z]

n’importe quel chiffre

n’importe quel caractère alphanumérique

[0-9]

[A-Za-z0-9]

n’importe quel caractère sauf A et B

Exemple : l’expression CG[^AB]T correspond à CG9T, CGCT… mais pas à

CGAT ni à CGBT.

[^AB]

caractère d’échappement (pour protéger certains caractères)

Exemple : l’expression \+ désigne le caractère + sans autre signification parti- culière. L’expression A\.G correspond à A.G et non pas à A suivi de n’importe quel caractère, suivi de G.

\

  1. à n fois le caractère précédent ou l’expression entre parenthèses précédente Exemple : l’expression A(CG)*T correspond à AT, ACGT, ACGCGT…
  2. à n fois le caractère précédent ou l’expression entre parenthèses précédente

*

+

Exemple : l’expression A(CG)+T correspond à ACGT, ACGCGT… mais pas à

AT.

0 à 1 fois le caractère précédent ou l’expression entre parenthèses précédente

?

Exemple : l’expression A(CG)?T correspond à AT ou ACGT.

n fois le caractère précédent ou l’expression entre parenthèses précédente

{n}

n à m fois le caractère précédent ou l’expression entre parenthèses précédente au moins n fois le caractère précédent ou l’expression entre parenthèses pré-

{n,m}

{n,}

cédente

au plus m fois le caractère précédent ou l’expression entre parenthèses précé-

{,m}

dente

chaînes de caractères CG ou TT

(CG|TT)

Exemple : l’expression A(CG|TT)C correspond à ACGC ou ATTC.

13.2 Module re et fonction search

Dans le module re, la fonction search() permet de rechercher un motif (pattern) au sein d’une chaîne de caractères avec une syntaxe de la forme search(motif, chaine). Si motif existe dans chaine, Python renvoie une instance MatchObject. Sans entrer dans les détails propres au langage orienté objet, si on utilise cette instance dans un test, il sera considéré comme vrai. Regardez cet exemple dans lequel on va rechercher le motif tigre dans la chaîne de caractères « girafe tigre singe » :

>>> import re

62

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

13.2

Module re et fonction search

13 Expressions régulières et parsing

>>>

>>>

animaux = « girafe tigre singe » re.search(‘tigre’, animaux)

<_sre.SRE_Match object at

>>> if re.search(‘tigre’,

0x7fefdaefe2a0> animaux):

… OK

print « OK »

Fonction match()

Il existe aussi la fonction match() dans le module re qui fonctionne sur le modèle de search(). La différence est qu’elle renvoie une instance MatchObject seulement lorsque l’expression régulière correspond (match) au début de la chaîne (à partir du premier caractère).

>>> animaux = « girafe tigre singe »

>>> re.search(‘tigre’, animaux)

<_sre.SRE_Match object at 0x7fefdaefe718>

>>> re.match(‘tigre’, animaux)

Nous vous recommandons plutôt l’usage de la fonction search(). Si vous souhaitez avoir une correspondance avec le début de la chaîne, vous pouvez toujours utiliser l’accroche de début de ligne ^.

Compilation d’expressions régulières

Il est aussi commode de préalablement compiler l’expression régulière à l’aide de la fonction

compile() qui renvoie un objet de type expression régulière :

>>> regex = re.compile(« ^tigre »)

>>> regex

<_sre.SRE_Pattern object at 0x7fefdafd0df0>

On peut alors utiliser directement cet objet avec la méthode search() :

>>>

>>>

>>>

>>>

animaux = « girafe tigre singe » regex.search(animaux)

animaux = « tigre singe » regex.search(animaux)

<_sre.SRE_Match object at 0x7fefdaefe718>

>>> animaux = « singe tigre »

>>> regex.search(animaux)

Groupes

Python renvoie un objet MatchObject lorsqu’une expression régulière trouve une cor- respondance dans une chaîne pour qu’on puisse récupérer des informations sur les zones de correspondance.

>>>

>>>

>>>

regex = re.compile(‘([0-9]+)\.([0-9]+)’) resultat = regex.search(« pi vaut 3.14 ») resultat.group(0)

‘3.14’

>>> resultat.group(1) ‘3’

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

63

13 Expressions régulières et parsing

13.2 Module re et fonction search

>>> resultat.group(2) ’14’

>>> resultat.start() 8

>>> resultat.end() 12

Dans cet exemple, on recherche un nombre composé

de plusieurs chiffres [0-9]+,

suivi d’un point \. (le point a une signification comme métacaractère, donc il faut l’échap- per avec \ pour qu’il ait une signification de point),

suivi d’un nombre à plusieurs chiffres [0-9]+.

Les parenthèses dans l’expression régulière permettent de créer des groupes qui seront ré- cupérés ultérieurement par la fonction group(). La totalité de la correspondance est donné par group(0), le premier élément entre parenthèse est donné par group(1) et le second par group(2).

Les fonctions start() et end() donnent respectivement la position de début et de fin de la zone qui correspond à l’expression régulière. Notez que la fonction search() ne renvoie que la première zone qui correspond à l’expression régulière, même s’il en existe plusieurs :

>>> resultat = regex.search(« pi vaut 3.14 et e vaut 2.72 »)

>>> resultat.group(0) ‘3.14’

Fonction findall()

Pour récupérer chaque zone, vous pouvez utiliser la fonction findall() qui renvoie une liste des éléments en correspondance.

>>>

>>>

>>>

regex = re.compile(‘[0-9]+\.[0-9]+’)

resultat = regex.findall(« pi vaut 3.14 et e vaut 2.72 ») resultat

[‘3.14’, ‘2.72’]

>>>

>>>

>>>

regex = re.compile(‘([0-9]+)\.([0-9]+)’)

resultat = regex.findall(« pi vaut 3.14 et e vaut 2.72 ») resultat

[(‘3′, ’14’), (‘2′, ’72’)]

Fonction sub()

Enfin, la fonction sub() permet d’effectuer des remplacements assez puissants. Par défaut la fonction sub(chaine1,chaine2) remplace toutes les occurrences trouvées par l’expres- sion régulière dans chaine2 par chaine1. Si vous souhaitez ne remplacer que les n premières occurrences, utilisez l’argument count=n :

>>>

‘pi

>>>

‘pi

regex.sub(‘quelque vaut quelque chose regex.sub(‘quelque vaut quelque chose

chose’, »pi vaut 3.14 et e vaut 2.72″) et e vaut quelque chose’

chose’, »pi vaut 3.14 et e vaut 2.72″, count=1) et e vaut 2.72′

Nous espérons que vous êtes convaincus de la puissance du module re et des expressions régulières, alors à vos expressions régulières !

64

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

13.3 Exercices : extraction des gènes d’un fichier genban1k3 Expressions régulières et parsing

13.3 Exercices : extraction des gènes d’un fichier genbank

Pour les exercices suivants, vous utiliserez le module d’expressions régulières re et le fichier genbank du chromosome I de la levure du boulanger Saccharomyces cerevisiae NC_001133.gbk.

1.

2.

Écrivez un script qui extrait l’organisme du fichier genbank NC_001133.gbk.

Modifiez le script précédent pour qu’il affiche toutes les lignes qui indiquent l’emplace- ment du début et de la fin des gènes, du type :

gene

58..272

3.

Faites de même avec les gènes complémentaires :

gene

complement(55979..56935)

4.

Récupérez maintenant la séquence nucléique et affichez-la à l’écran. Vérifiez que vous n’avez pas fait d’erreur en comparant la taille de la séquence extraite avec celle indiquée dans le fichier genbank.

Mettez cette séquence dans une liste et récupérez les deux premiers gènes (en les affi- chant à l’écran). Attention, le premier gène est un gène complémentaire, n’oubliez pas de prendre le complémentaire inverse de la séquence extraite.

À partir de toutes ces petites opérations que vous transformerez en fonctions, concevez un programme genbank2fasta.py qui extrait tous les gènes d’un fichier genbank fourni en argument et les affiche à l’écran. Pour cela vous pourrez utiliser tout ce que vous avez vu jusqu’à présent (fonctions, listes, modules, etc.).

À partir du script précédent, refaites le même programme (genbank2fasta.py) en écri- vant chaque gène au format fasta dans un fichier.

Pour rappel, l’écriture d’une séquence au format fasta est le suivant :

>ligne de commentaire

5.

6.

7.

sequence suite de suite de

sur une ligne de 80 caractères maxi la séquence …………………..

la séquence …………………..

Vous utiliserez comme ligne de commentaire le nom de l’organisme, suivi du numero du gène, suivi des positions de début et de fin du gène, comme dans cet exemple

>Saccharomyces cerevisiae 1 1807 2169

Les noms des fichiers fasta seront de la forme gene1.fasta, gene2.fasta, etc.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

65

14 Création de modules

  1. Création de modules
    1. Création

Vous pouvez créez votres propres modules très simplement en Python. Il vous suffit d’écrire un ensemble de fonctions (et/ou de variables) dans un fichier, puis d’enregistrer celui-ci avec une extension .py (comme n’importe quel script Python). À titre d’exemple, voici le contenu du module message.py.

«  » »Module inutile qui affiche «  » »

des

messages

🙂

def

Bonjour(nom): «  » »Affiche bonjour ! «  » »

return « bonjour  » + nom

def

Ciao(nom): «  » »Affiche ciao ! «  » »

return « ciao  » + nom

def

Hello(nom): «  » »Affiche hello ! «  » »

return « hello  » + nom +  »

! »

date=16092008

14.2 Utilisation

Pour appeler une fonction ou une variable de ce module, il faut que le fichier message.py soit dans le répertoire courant (dans lequel on travaille) ou bien dans un répertoire indiqué par la variable d’environnement Unix PYTHONPATH. Ensuite, il suffit d’importer le module et toutes ses fonctions (et variables) vous sont alors accessibles.

La première fois qu’un module est importé, Python crée un fichier avec une extension .pyc

(ici message.pyc) qui contient le bytecode (code précompilé) du module.

L’appel du module se fait avec la commande import message. Notez que le fichier est bien enregistré avec une extension .py et pourtant on ne la précise pas lorsqu’on importe le module. Ensuite on peut utiliser les fonctions comme avec un module classique.

>>> import message

>>> message.Hello(« Joe ») ‘hello Joe !’

>>> message.Ciao(« Bill ») ‘ciao Bill’

>>> message.Bonjour(« Monsieur ») ‘bonjour Monsieur’

>>>

message.date

16092008

Les commentaires (entre triple guillemets) situés en début de module et sous chaque fonc- tion permettent de fournir de l’aide invoquée ensuite par la commande help() :

66

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

14.3 Exercices

14

Création de modules

>>> help(message) NAME

message – Module inutile qui affiche des messages

🙂

FILE

/home/cumin/poulain/message.py

FUNCTIONS

Hello(nom)

Affiche hello !

Bonjour(nom)

Affiche bonjour !

Ciao(nom)

Affiche ciao !

DATA

date = 16092008

Remarques :

  • Les fonctions dans un module peuvent s’appeler les unes les autres.
  • Les fonctions dans un module peuvent appeler des fonctions situées dans un autre mo- dule s’il a été préalablement importé avec la commande import.

Vous voyez que les modules sont d’une simplicité enfantine à créer. Si vous avez des fonc- tions que vous serez amenés à utiliser souvent, n’hésitez plus !

14.3 Exercices

Conseil : pour cet exercice, écrivez un script dans un fichier, puis exécutez-le dans un shell.

1.

Reprenez l’ensemble des fonctions qui gèrent le traitement de séquences nucléiques et incluez-les dans un module adn.py. Testez-les au fur et à mesure.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

67

15 Autres modules d’intérêt

15

Autres modules d’intérêt

Nous allons voir dans cette section deux modules qui peuvent se révéler très pratiques.

Le premier (urllib2) permet de télécharger n’importe quel fichier depuis internet. Le second (pickle) permet d’enregistrer des objets python pour pouvoir les retrouver tels quels plus tard. Ces deux modules sont présents par défaut dans n’importe quelle distribution Python.

15.1 Module urllib2

Les modules urllib et urllib2 permettent de rapatrier, directement avec Python, des fichiers depuis internet. Nous n’aborderons ici que des exemples simples, mais libre à vous d’approfon- dir si besoin. Il existe des différences subtiles entre urllib et urllib2 que nous n’aborderons pas ici mais qui sont consultables sur la documentation officielle de Python. Dans ce cours, nous avons choisi de vous présenter urllib2 car une des fonctions principales (urlopen()) est considérée comme obsolète dans urllib depuis la version 2.6 de Python.

Prenons un exemple simple, supposons que vous souhaitiez rapatrier le fichier PDB de la protéine barstar. En Unix vous utiliseriez probablement la commande wget, regardez comment faire en Python :

>>>

>>>

>>>

>>>

>>>

import urllib2

u = urllib2.urlopen(« http://www.pdb.org/pdb/files/1BTA.pdb ») pdb_lines = u.readlines()

u.close()

for

i in pdb_lines: print i,

HEADER TITLE TITLE COMPND COMPND COMPND COMPND SOURCE SOURCE SOURCE […]

>>>

RIBONUCLEASE INHIBITOR

09-MAY-94

1BTA

THREE-DIMENSIONAL SOLUTION STRUCTURE AND 13C ASSIGNMENTS

2 BARSTAR USING NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY MOL_ID: 1;

OF

2

3

4

MOLECULE: BARSTAR; CHAIN: A; ENGINEERED: YES

MOL_ID: 1;

  1. ORGANISM_SCIENTIFIC: BACILLUS AMYLOLIQUEFACIENS;
  2. ORGANISM_TAXID: 1390

Comme vous le voyez, il suffit d’utiliser la fonction urlopen() et de lui passer en argu- ment une URL (i.e. adresse internet) sous forme de chaîne de caractères. Dès lors, les méthodes associées aux fichiers (cf chapitre 6) sont accessibles (read(), readline(), readlines(), etc.).

Il est également possible d’enregistrer le fichier téléchargé :

>>>

>>>

>>>

>>>

>>>

>>>

>>>

import urllib2

u = urllib2.urlopen(« http://www.pdb.org/pdb/files/1BTA.pdb ») pdb_file_content = u.read()

u.close()

f = open(« 1BTA.pdb », »w ») f.write(pdb_file_content) f.close()

68

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

15.2 Module pickle

15 Autres modules d’intérêt

Dans ce dernier exemple, nous récupérons le fichier complet sous la forme d’une chaîne de caractères unique (avec la fonction read()). Le fichier est ensuite enregistré dans le répertoire courant (duquel vous avez lancé l’interpréteur Python). Nous vous laissons imaginer comment faire sur une série de plusieurs fichiers (cf. exercices).

15.2 Module pickle

Le module pickle permet d’effectuer une sérialisation et désérialisation des données. Il s’agit en fait d’encoder (d’une manière particulière) les objets que l’on peut créer en Python (variables, listes, dictionnaires, fonctions, classes, etc.) afin de les stocker dans un fichier, puis de les récupérer, sans devoir effectuer une étape de parsing.

15.2.1 Codage des données

Pour encoder des données avec pickle et les envoyer dans un fichier, on peut utiliser la fonction dump(obj,file) (où file est un fichier déjà ouvert) :

>>>

>>>

>>>

>>>

import pickle

fileout maliste mondico

=

=

=

open(« mydata.dat », »w ») range(10)

{‘year’: 2000, ‘name’: ‘Far beyond driven’,

‘author’:

‘Pantera’,

‘style’: ‘Trash Metal’}

>>>

>>>

>>>

>>>

pickle.dump(maliste,fileout) pickle.dump(mondico,fileout) pickle.dump(3.14,fileout) fileout.close()

Si on observe le fichier créé, on s’aperçoit que les données sont codées :

>>> import os

>>> os.system(« cat (lp0

I0

aI1 aI2 aI3 aI4 aI5 aI6 aI7 aI8 aI9 a.(dp0

S’style’ p1

S’Trash Metal’ p2

sS’author’ p3 S’Pantera’ p4 sS’name’ p5

mydata.dat »)

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

69

15 Autres modules d’intérêt

15.3 Exercices

S’Far beyond driven’ p6

sS’year’ p7 I2000

s.F3.1400000000000001

.0

>>>

15.2.2 Décodage des données

Pour décoder les données, rien de plus simple, il suffit d’utiliser la fonction load(file)

où file est un fichier ouvert en lecture :

>>>

>>> [0,

>>>

filein = open(« mydata.dat ») pickle.load(filein)

1, 2, 3, 4, 5, 6, 7, 8, 9]

pickle.load(filein)

{‘style’: ‘Trash Metal’, ‘year’: 2000, ‘name’: ‘Far beyond driven’, ‘author’: ‘Pantera’}

>>> pickle.load(filein) 3.1400000000000001

Attention à ne pas utiliser la fonction load une fois de trop, sinon une erreur est générée :

>>> pickle.load(filein)

Traceback (most recent call last): File « <stdin> », line 1, in <module>

File « /usr/lib/python2.5/pickle.py », return Unpickler(file).load()

File « /usr/lib/python2.5/pickle.py », dispatch[key](self)

File « /usr/lib/python2.5/pickle.py », raise EOFError

EOFError

>>>

line

1370, in load

line

858, in load

line

880, in load_eof

Il est à noter qu’il existe un module équivalent mais beaucoup plus rapide, le module cpi- ckle.

15.3

1.

Exercices

Concevez un script qui rapatrie de manière automatique le fichier 1MSE.pdb depuis la

Protein Data Bank (à l’aide du module urllib2).

On souhaite récupérer les structure 3D de la partie N-terminale de la protéine HSP90 en présence de différents co-cristaux, les codes PDB sont 3K97, 3K98 et 3K99. Écrivez un script Python qui télécharge de manière automatique les fichiers PDB (à l’aide du module urllib2 et d’une boucle) et les enregistre dans le répertoire courant.

Reprenez le dictionnaire des mots de 4 lettres du génome du chromosome I de la levure S. cerevisiae (exercice 7 sur les dictionnaires et tuples). Encodez le dictionnaire dans un fichier avec le module pickle. Quittez Python et regardez attentivement le fichier généré avec un éditeur de texte. Relancez Python, et décodez le dictionnaire.

2.

3.

70

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

16 Modules d’intérêt en bioinformatique

16

Modules d’intérêt en bioinformatique

Nous allons voir dans cette section quelques modules très importants en bioinformatique.

Le premier numpy permet notamment de manipuler des vecteurs et des matrices en Python.

Le module biopython permet de travailler sur des données biologiques type séquence (nu- cléique et protéique) ou structure (fichier PDB). Le module matplotlib permet de dessiner des graphiques depuis Python. Enfin, le module rpy permet d’interfacer n’importe quelle fonc- tion du puissant programme R.

Ces modules ne sont pas fournis avec le distribution Python de base (contrairement à tous les autres modules vus précédemment). Nous ne nous étendrons pas sur la manière de les installer. Consultez pour cela la documentation sur les sites internet des modules en question. Sachez cependant que ces modules existent dans la plupart des distributions Linux récentes.

Dans ce chapitre, nous vous montrererons quelques exemples d’utlisation de ces modules pour vous convaincre de leur pertinence.

16.1 Module numpy

Le module numpy est incontournable en bioinformatique. Il permet d’effectuer des calculs sur des vecteurs ou des matrices, élément par élément, via un nouveau type d’objet appelé array. Ce module contient des fonctions de base pour faire de l’algèbre linéaire, des transfor- mées de Fourier ou encore des tirages de nombre aléatoire plus sophistiqués qu’avec le module random. Vous pourrez trouver les sources de numpy à cette adresse. Notez qu’il existe un autre module scipy que nous n’aborderons pas dans ce cours. scipy est lui même basé sur numpy, mais il en étend considérablement les possibilités de ce dernier (e.g. statistiques, optimisation, intégration numérique, traitement du signal, traitement d’image, algorithmes génétiques, etc.).

16.1.1 Objets de type array

Les objets de type array correspondent à des tableaux à une ou plusieurs dimensions et permettent d’effectuer du calcul vectoriel. La fonction array() permet la conversion d’un objet séquentiel (type liste ou tuple) en un objet de type array. Voici un exemple simple de conversion d’une liste à une dimension en objet array :

>>>

>>>

>>>

import numpy a = [1,2,3]

numpy.array(a)

array([1, 2, 3])

>>> b = numpy.array(a)

>>> type(b)

<type ‘numpy.ndarray’>

>>> b

array([1, 2, 3])

Nous avons converti la liste a en array, mais cela aurait donné le même résultat si on avait converti le tuple (1,2,3). Par ailleurs, vous voyez que lorsqu’on demande à Python le contenu d’un objet array, les symboles ([]) sont utilisés pour le distinguer d’une liste [] ou d’un tuple ().

Notez qu’un objet array ne peut contenir que des valeurs numériques. Vous ne pouvez pas, par exemple, convertir une liste contenant des chaînes de caractères en objet de type array.

La fonction arange() est équivalente à range() et permet de construire un array à une dimension de manière simple.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

71

16 Modules d’intérêt en bioinformatique

16.1 Module numpy

>>> numpy.arange(10) array([0, 1, 2, 3, 4, 5, 6,

>>> numpy.arange(10.0)

7, 8, 9])

array([ 0.,

1.,

2.,

3.,

4., 5.,

6., 7., 8.,

9.])

>>> numpy.arange(10,0,-1)

array([10,

>>>

9,

8,

7,

6,

5,

4,

3,

2,

1])

Un des avantages de la fonction arange() est qu’elle permet de générer des objets array

qui contiennent des entiers ou de réels selon l’argument qu’on lui passe.

La différence fondamentale entre un objet array à une dimension et une liste (ou un tuple) est que celui-ci est considéré comme un vecteur. Par conséquent on peut effectuer des opérations élément par élément dessus, ce qui est bien commode lorsqu’on analyse de grandes quantités de données. Regardez ces exemples :

>>> v = numpy.arange(4)

>>> v

array([0, 1,

>>> v + 1

array([1, 2,

2, 3])

3, 4])

>>> v +

array([

0.1

0.1,

2

1.1, 2.1,

3.1])

>>> v

*

array([0, 2,

4, 6])

>>> v v

* array([0, 1,

4, 9])

Notez bien sur le dernier exemple de multiplication que l’array final correspond à la multi- plication élément par élément des deux array initiaux. Avec les listes, ces opérations n’auraient été possibles qu’en utilisant des boucles ! Nous vous encourageons donc à utiliser dorénavent les objets array lorsque vous aurez besoin de faire des opérations élément par élément.

Il est aussi possible de construire des objets array à deux dimensions, il suffit de passer en argument une liste de listes à la fonction array() :

>>> numpy.array([[1,2,3],[2,3,4],[3,4,5]])

array([[1,

[2,

[3,

>>>

2,

3,

4,

3],

4],

5]])

Attention, plus complexe encore ! On peut aussi créer des tableaux à trois dimensions en passant à la fonction array() une liste de listes de listes :

>>> numpy.array([[[1,2],[2,3]],[[4,5],[5,6]]])

array([[[1,

[2,

2],

3]],

[[4,

[5,

5],

6]]])

>>>

72

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

16.1 Module numpy

16 Modules d’intérêt en bioinformatique

La fonction array() peut créer des tableaux à n’importe quel nombre de dimensions. Tou- tefois ça devient vite compliqué lorsqu’on dépasse trois dimensions. Retenez qu’un objet array à une dimension peut être considéré comme un vecteur et un array à deux dimensions comme une matrice.

Pour récupérer un ou plusieurs élément(s) d’un objet array, vous pouvez utiliser l’indiçage ou les tranchage, de la même manière que pour les listes.

>>> a = numpy.arange(10)

>>> a

array([0, 1,

>>> a[5:]

array([5, 6,

>>> a[::2]

array([0, 2,

>>> a[1] 1

2,

3,

4, 5, 6, 7, 8, 9])

7,

8,

9])

4,

6,

8])

Dans le cas d’un objet array à deux dimensions, vous pouvez récupérer une ligne, une co- lonne ou bien un seul élément.

>>> a = numpy.array([[1,2],[3,4]])

>>> a

array([[1, 2],

[3, 4]])

>>> a[:,0]

array([1, 3])

>>> a[0,:]

array([1, 2])

>>> a[1,1] 4

La syntaxe a[m,:] récupère la ligne m-1, et a[:,n] récupère la colonne n-1. Les tranches sont évidemment aussi utilisables sur un tableau à deux dimensions.

Il peut être parfois pénible de construire une matrice (array à deux dimensions) à l’aide d’une liste de listes. Le module numpy contient quelques fonctions commodes pour construire des matrices à partir de rien. Les fonctions zeros() et ones() permettent de construire des objets array contenant des 0 ou de 1, respectivement. Il suffit de leur passer un tuple indiquant la dimensionnalité voulue.

>>> numpy.zeros((3,3))

array([[

[

[

0.,

0.,

0.,

0.,

0.,

0.,

0.],

0.],

0.]])

>>> numpy.zeros((3,3),int)

array([[0,

[0,

[0,

0,

0,

0,

0],

0],

0]])

>>> numpy.ones((3,3))

array([[

[

[

1.,

1.,

1.,

1.,

1.,

1.,

1.],

1.],

1.]])

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

73

16 Modules d’intérêt en bioinformatique

16.1 Module numpy

Par défaut, les fonctions zeros() et ones() génèrent des réels, mais vous pouvez deman- der des entiers en passant l’option int en second argument.

Enfin il existe les fonctions reshape() et resize() qui permettent de remanier à volonté les dimensions d’un array. Il faut pour cela, leur passer en argument l’objet array à remanier ainsi qu’un tuple indiquant la nouvelle dimensionnalité.

>>> a = numpy.arange(9)

>>> a

array([0, 1, 2, 3, 4, 5, 6, 7, 8])

>>> numpy.reshape(a,(3,3))

array([[0,

[3,

[6,

1,

4,

7,

2],

5],

8]])

Toutefois, reshape() attend un tuple dont la dimension est compatible avec le nombre d’éléments contenus dans l’array de départ, alors que resize() s’en moque et remplira le nouvel objet array généré même si les longueurs ne coincident pas.

>>> a = numpy.arange(9)

>>> a.reshape((2,2))

Traceback (most recent File « <stdin> », line ValueError: total size

call last):

1, in <module>

of new array must be unchanged

>>> numpy.resize(a,(2,2)) array([[0, 1],

[2, 3]])

>>> numpy.resize(a,(4,4))

array([[0,

[4,

[8,

[3,

1,

5,

0,

4,

2,

6,

1,

5,

3],

7],

2],

6]])

Dans l’exemple précédent, la fonction reshape() renvoie une erreur si les dimensions ne coïncident pas. La fonction resize() duplique ou coupe la liste initiale s’il le faut jusqu’à temps que le nouvel array soit rempli.

Si vous ne vous souvenez plus de la dimension d’un objet array, la fonction shape() per- met d’en retrouver la taille.

>>> a = numpy.arange(3)

>>> numpy.shape(a) (3,)

Enfin, la fonction transpose() renvoie la transposée d’un array. Par exemple pour une matrice :

>>> a

array([[1,

[4,

[7,

2,

5,

8,

3],

6],

9]])

>>> numpy.transpose(a)

array([[1,

[2,

[3,

4,

5,

6,

7],

8],

9]])

74

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

16.1 Module numpy

16 Modules d’intérêt en bioinformatique

16.1.2 Un peu d’algèbre linéaire

Après avoir manipulé les vecteurs et les matrices, voici quelques fonctions pour faire de l’algèbre linéaire.

La fonction dot() vous permet de faire une multiplication de matrices.

>>> a = numpy.resize(numpy.arange(4),(2,2))

>>> a

array([[0, 1],

[2, 3]])

>>> numpy.dot(a,a) array([[ 2, 3],

[ 6, 11]])

>>> a a

* array([[0, 1],

[4, 9]])

Notez bien que dot(a,a) renvoie le produit matriciel entre deux matrices, alors que a*a

renvoie le produit élément par élément 1.

Pour toutes les opérations suivantes, il faudra utiliser des fonctions dans le sous-module numpy.linalg. La fonction inv() renvoie l’inverse d’une matrice carrée, det() son déter- minant, eig() ses vecteurs et valeurs propres.

>>> a

array([[0, 1],

[2, 3]])

>>> numpy.linalg.inv(a)

array([[-1.5,

[ 1. ,

0.5],

0. ]])

>>> numpy.linalg.det(a)

-2.0

>>> numpy.linalg.eig(a)

(array([-0.56155281, 3.56155281]), array([[-0.87192821, -0.27032301],

[ 0.48963374, -0.96276969]]))

>>> numpy.linalg.eig(a)[0]

array([-0.56155281,

3.56155281])

>>> numpy.linalg.eig(a)[1]

array([[-0.87192821,

[ 0.48963374,

-0.27032301],

-0.96276969]])

Notez que la fonction eig() renvoie un tuple dont le premier élément correspond aux valeurs propres et le second élément aux vecteurs propres.

16.1.3 Un peu de transformée de Fourier

La transformée de Fourier est très utilisée pour l’analyse de signaux, notamment lorsqu’on souhaite extraire des périodicités au sein d’un signal bruité. Le module numpy possède la fonc- tion fft() (dans le sous-module fft) permettant de calculer des transformées de Fourier.

Voici un petit exemple sur la fonction cosinus de laquelle on souhaite extraire la période à l’aide de la fonction fft() :

1. Dans numpy, il existe également des objets de type matrix pour lesquels les multiplications de matrices sont différents, mais nous ne les aborderons pas ici.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

75

16 Modules d’intérêt en bioinformatique

16.2 Module biopython

# 1) on definit la fonction y = cos(x) import numpy

debut

= 2

-2 numpy.pi

* numpy.pi

fin pas

=

=

*

0.1

x y

=

=

numpy.arange(debut,fin,pas) numpy.cos(x)

#

2) on calcule la TF de la fonction cosinus

TF=numpy.fft.fft(y) ABSTF = numpy.abs(TF)

# abcisse du spectre en radian^-1 pas_xABSTF = 1/(fin-debut)

x_ABSTF = numpy.arange(0,pas_xABSTF len(ABSTF),pas_xABSTF)

*

Plusieurs commentaires sur cet exemple.

Vous constatez que numpy redéfinit certaines fonctions ou constantes mathématiques de

base, comme pi (nombre π), cos() (fonction cosinus) ou abs() (valeur absolue, ou mo- dule d’un complexe). Ceci est bien pratique car nous n’avons pas à appeler ces fonctions ou constantes depuis le module math, le code en est ainsi plus lisible.

Dans la partie 1), on définit le vecteur x représentant un angle allant de -2π à 2π radians par pas de 0,1 et le vecteur y comme le cosinus de x.

En 2) on calcule la transformée de Fourier avec la fonction fft() qui renvoie un vec- teur (objet array à une dimension) de nombres complexes. Eh oui, le module numpy gère aussi les nombres complexes ! On extrait ensuite le module du résultat précédent avec la fonction abs().

La variable x_ABSTFL représente l’abscisse du spectre (en radian-1).

La variable ABSTF contient le spectre lui même. L’analyse de ce dernier nous donne un pic à 0,15 radian-1, ce qui correspond bien à 2π (plutôt bon signe de retrouver ce résultat). Le graphe de ce spectre est présenté dans la partie dédiée à matplotlib (section 16.3).

Notez que tout au long de cette partie, nous avons toujours utilisé la syntaxe numpy.fonction() pour bien vous montrer quelles étaient les fonctions propres à numpy. Bien sûr dans vos futurs scripts il sera plus commode d’importer complètement le module numpy avec l’instruction

from numpy import *. Vous pourrez ensuite appeler les fonctions de numpy directement (sans le préfixe numpy.).

Si vous souhaitez quand même spécifier pour chaque fonction numpy son module d’appar- tenance, vous pouvez définir un alias pour numpy avec l’instruction import numpy as np. Le module numpy est alors connu sous le nom np. Par l’appel de la fonction array() se fera par np.array().

16.2 Module biopython

Le module biopython propose de nombreuses fonctionnalités très utiles en bioinformatique.

Le tutoriel est particulièrement bien fait, n’hésitez pas à le consulter.

Voici quelques exemples d’utilisation. Définition d’une séquence.

>>>

>>>

>>>

>>>

>>>

import Bio

from Bio.Seq import Seq

from Bio.Alphabet import IUPAC

ADN = Seq(« ATATCGGCTATAGCATGCA », IUPAC.unambiguous_dna) ADN

Seq(‘ATATCGGCTATAGCATGCA’, IUPACUnambiguousDNA())

76

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

16.3 Module matplotlib

16 Modules d’intérêt en bioinformatique

IUPAC.unambiguous_dna signifie que la séquence entrée est bien une séquence d’ADN.

Obtention de la séquence complémentaire et complémentaire inverse.

>>> ADN.complement()

Seq(‘TATAGCCGATATCGTACGT’, IUPACUnambiguousDNA())

>>> ADN.reverse_complement() Seq(‘TGCATGCTATAGCCGATAT’, IUPACUnambiguousDNA())

Traduction en séquence protéique.

>>> ADN.translate() Seq(‘ISAIAC’, IUPACProtein())

16.3 Module matplotlib

Le module matplotlib permet de générer des graphes interactifs depuis Python. Il est l’outil complémentaire de numpy et scipy lorsqu’on veut faire de l’analyse de données.

Nous ne présenterons ici qu’un petit exemple traitant de la représentation graphique de la fonction cosinus et de la recherche de sa période par transformée de Fourier (voir également la section 16.1.3).

Plutôt qu’un long discours, regardez cet exemple que nous commenterons après.

# define cosine function

from pylab

import

*

debut

= 2

-2

*

pi

*

fin pas

=

=

pi

0.1

x y

=

=

arange(debut,fin,pas) cos(x)

#

draw the plot

plot(x,y) xlabel(‘angle (rad)’) ylabel(‘cos(angle)’)

title(‘Fonction: y = cos(x)’) grid()

show()

Vous devriez obtenir une image comme celle-ci :

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

77

16

Modules d’intérêt en bioinformatique

16.3

Module matplotlib

Vous constatez que le module matplotlib génère un fenêtre graphique interactive per- mettant à l’utilisateur de votre script de manipuler le graphe (enregistrer comme image, zoo- mer, etc.).

Revenons maintenant sur le code. Tout d’abord, vous voyez qu’on importe le module s’ap- pelle pylab (et non pas matplotlib). Le module pylab importe lui-même toutes les fonc- tions (et variables) du module numpy (e.g. pi, cos, arange, etc.). Il est plus commode de l’importer par from pylab import * que par import pylab.

La partie qui nous intéresse (après la ligne # draw the plot) contient les parties spéci-

fiques à matplotlib. Vous constatez que les commandes sont très intuitives.

La fonction plot() va générer un graphique avec des lignes et prend comme valeurs en abscisse (x) et en ordonnées (y) des vecteurs de type array à une dimension.

Les fonctions xlabel() et ylabel() sont utiles pour donner un nom aux axes.

title() permet de définir le titre du graphique.

grid() affiche une grille en filligrane.

Jusqu’ici, aucun graphe n’est affiché. Pour activer l’affichage à l’écran du graphique, il faut appeler la fonction show(). Celle-ci va activer une boucle dite gtk qui attendra les manipulations de l’utilisateur.

Les commandes Python éventuellement situées après la fonction show() seront exécu- tées seulement lorsque l’utilisateur fermera la fenêtre graphique (petite croix en haut à droite).

Voici maintenant l’exemple complet sur la fonction cosinus et sa transformée de Fourier.

from pylab import

*

#

x y

define cosine function

= arange(-2*pi,2*pi,0.1)

= cos(x)

#

calculate TF of cosine function

TF=fft(y)

78

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

16.4 Module rpy

16 Modules d’intérêt en bioinformatique

ABSTF = abs(TF)

pas_xABSTF = 1/(4*pi)

x_ABSTF = arange(0,pas_xABSTF

len(ABSTF),pas_xABSTF)

*

# draw cos plot plot(x,y) xlabel(‘angle (rad)’) ylabel(‘cos(angle)’)

title(‘Fonction: y = cos(x)’) grid()

show()

# plot TF of cosine plot(x_ABSTF[:20],ABSTF[:20])

xlabel(‘inverse angle (rad^-1)’) ylabel(‘Intensity’)

title(‘Spectrum of cosine function’) grid()

show()

Le premier graphe doit afficher la fonction cosinus comme ci-dessus et le second doit res- sembler à cela :

On retrouve bien le pic à 0,15 radian-1 correspondant à 2π radians. Voilà, nous espèrons que

ce petit exemple vous aura convaincu de l’utilité du module matplotlib. Sachez qu’il peut faire bien plus, par exemple générer des histogrammes ou toutes sortes de graphiques utiles en analyse de données.

16.4 Module rpy

R est un programme extrêmement puissant permettant d’effectuer des analyses statistiques. Il contient tout un tas de fonctions permettant de générer divers types de graphiques. Nous

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

79

16 Modules d’intérêt en bioinformatique

16.4 Module rpy

ne rentrerons pas dans les détails de R, mais nous vous montrerons quelques exemples pour générer des graphiques avec R depuis Python.

Les vecteurs de R peuvent être remplacés par des listes en Python. En interne, rpy manipule des variables de types array car il est basé sur le module numpy vu précédemment. Dans cet exemple, nous allons tracé les coordonnées aléatoires de 50 points.

import random import rpy

#

x #

y

construction d’une liste de

= range(1, 51) construction d’une liste de

= []

50 éléments croissants

50 éléments aléatoires

for i in x:

y.append( random.random()

)

# enregistrement du graphique rpy.r.png(« rpy_test1.png »)

# dessin des points

dans un fichier png

rpy.r.plot(x, y, xlab= »position », # fin du graphique rpy.r.dev_off()

ylab= »coordonnées »,

col= »black »,

pch=3)

Voici le fichier rpy_test1.png obtenu :

Les fonctions R sont accessibles par le sous-module r du module rpy. Les fonctions png() et plot() sont utilisables comme en R. Les fonctions qui contiennent un point dans leur nom en R (dev.off()) sont utilisables avec un caractère souligné « _ » à la place (ici dev_off()).

Voyons maintenant un exemple plus intéressant, pour lequel on calcule la distribution des différentes bases dans une séquence nucléique :

from rpy import r as R

seq = « ACGATCATAGCGAGCTACGTAGAA »

seq2 = list( seq )

80

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

16.5 Exercice numpy

16 Modules d’intérêt en bioinformatique

R.png(« rpy_test2.png »)

# tri des bases car # alors que table() seq3 = R.sort( seq2

unique() n’ordonne pas les données le fait

)

# listes des bases présentes bases = R.unique( seq3 )

# effectif de chaque base effectifs = R.table( seq3 )

# dessin du barplot et sauvegarde de la position des abscisses

coords = R.barplot( effectifs, ylab= »nombre

de bases »)

# ajout du texte pour l’axe des R.text(coords, -0.5, bases, xpd R.dev_off()

Voici le fichier rpy_test2.png obtenu :

abscisses

=

True,

cex

=

1.5,

font

=

2

)

Pour plus de concision, le module rpy.r est renomé en R. Les booléens TRUE et FALSE en R (dans la fonction text()) doivent être remplacés par leurs équivalents en Python (True et False ; attention à la casse).

16.5 Exercice numpy

Cet exercice présente le calcul de la distance entre deux carbones alpha consécutifs de la barstar. Il demande quelques notions d’Unix et nécessite le module numpy de Python.

1.

2.

Téléchargez le fichier 1BTA.pdb sur le site de la PDB.

Pour que le séparateur décimal soit le point (au lieu de la virgule, par défaut sur les systèmes d’exploitation français), il faut au préalable redéfinir la variable LC_NUMERIC en bash :

export LC_NUMERIC=C

Extrayez les coordonnées atomiques de tous les carbones alpha de la barstar dans le fi- chier 1BTA_CA.txt avec la commande Unix suivante :

awk ‘$1== »ATOM » && $3== »CA » {printf « %.3f %.3f %.3f « , $7, $8, $9}’ 1BTA.pdb > 1BTA_CA.txt

Les coordonnées sont toutes enregistrées sur une seul ligne, les unes après les autres, dans le fichier 1BTA_CA.txt.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

81

16 Modules d’intérêt en bioinformatique

16.6 Exercice rpy

3.

Ouvrez le fichier 1BTA_CA.txt avec Python et créez une liste contenant toutes les coor- données sous forme de réels avec les fonctions split() et float().

Avec la fonction array() du module numpy, convertissez cette liste en matrice.

Avec la fonction reshape() de numpy, et connaissant le nombre d’acides aminés de la barstar, construisez une matrice à deux dimensions contenant les coordonnées des car- bones alpha.

Créez une matrice qui contient les coordonnées des n-1 premiers carbones alpha et une autre qui contient les coordonnées des n-1 derniers carbones alpha.

En utilisant les opérateurs mathématiques habituels (-, **2, +) et les fonctions sqrt() et

sum() du module numpy, calculez la distance entre les atomes n et n+1.

Affichez les distances entre carbones alpha consécutifs et repérez la valeur surprenante.

4.

5.

6.

7.

8.

16.6

1.

Exercice rpy

Soit la séquence protéique WVAAGALTIWPILGALVILG. Représentez avec le module

rpy la distribution des différents acides aminés.

Reprenez l’exercice du calcul de la distance entre deux carbones alpha consécutifs de la barstar avec numpy et représentez cette distance avec rpy.

2.

82

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

17 Avoir la classe avec les objets

17

Avoir la classe avec les objets

Une classe permet de définir des objets qui sont des représentants (des instances) de cette

classe. Les objets peuvent posséder des attributs (variables associées aux objets) et des mé-

thodes (∼ fonctions associées aux objets).

Exemple de la classe Rectangle :

class Rectangle:

« ceci est la classe Rectangle » # initialisation d’un objet

# définition des attributs avec des valeurs par défaut

def init (self, long = 0.0, larg = 0.0, coul = « blanc »): self.longueur = long

self.largeur = self.couleur =

# definition de la

larg coul

méthode qui calcule la surface

def calculSurface(self):

print « surface = %.2f m2 » %(self.longueur self.largeur)

*

# definition de la méthode qui transforme un rectangle en carré def changeCarre(self, cote):

self.longueur = cote self.largeur = cote

Ici, longueur, largeur et couleur sont des attributs alors que calculPerimetre(), calculSurface() et changeCarre() sont des méthodes. Tous les attributs et toutes les méthodes se réfèrent toujours à self qui désigne l’objet lui même. Attention, les méthodes prennent toujours au moins self comme argument.

Exemples d’utilisation de la classe Rectangle :

# création d’un objet Rectangle avec rect1 = Rectangle()

print rect1.longueur, rect1.largeur, # sans surprise : rect1.calculSurface()

# on change le rectangle en carré rect1.changeCarre(30) rect1.calculSurface()

# création d’un objet Rectangle avec rect2 = Rectangle(2, 3, « rouge ») rect2.calculSurface()

les paramètres par défaut

rect1.couleur

des paramètres imposés

17.1 Exercices

Conseil : pour ces exercices, écrivez des scripts dans des fichiers, puis exécutez-les dans un

shell.

1.

Entraînez-vous avec la classe Rectangle. Créez la méthode calculPerimetre() qui calcule le périmère d’un objet rectangle.

Créez une nouvelle classe Atome avec les attributs x, y, z (qui contiennent les coor- données atomique) et la méthode calculDistance(). Testez cette classe sur plusieurs exemples.

Améliorez la classe Atome avec de nouveaux attributs (par ex. : masse, charge, etc.) et de nouvelles méthodes (par ex. : calculCentreMasse(), calculRayonGyration()).

2.

3.

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

83

18 Gestion des erreurs

18

Gestion des erreurs

La gestion des erreurs permet d’éviter que votre programme plante en prévoyant vous

même les sources d’erreurs éventuelles.

Voici un exemple dans lequel on demande à l’utilisateur d’entrer un nombre, puis on affiche

ce nombre.

>>> nb = int(raw_input(« Entrez un nombre: « )) Entrez un nombre: 23

>>> print nb 23

La fonction raw_input() permet à l’utilisateur de saisir une chaîne de caractères. Cette chaîne de caractères est ensuite transformée en nombre entier avec la fonction int().

Si l’utilisateur ne rentre pas un nombre, voici ce qui se passe :

>>> nb = int(raw_input(« Entrez un nombre: « )) Entrez un nombre: ATCG

Traceback (most recent call last): File « <stdin> », line 1, in <module>

ValueError: invalid literal for int() with base 10: ‘ATCG’

L’erreur provient de la fonction int() qui n’a pas pu convertir la chaîne de caractères

« ATCG » en nombre, ce qui est normal.

Le jeu d’instruction try / except permet de tester l’exécution d’une commande et d’in- tervenir en cas d’erreur.

>>>

try:

nb = int(raw_input(« Entrez un nombre: « )) except:

print « Vous n’avez pas entré un nombre ! »

Entrez un nombre: ATCG

Vous n’avez pas entré un nombre !

Dans cette exemple, l’erreur renvoyée par la fonction int() (qui ne peut pas convertir

« ATCG » en nombre) est interceptée et déclenche l’affichage du message d’avertissement.

On peut ainsi redemander sans cesse un nombre à l’utilisateur, jusqu’à ce que celui-ci en rentre bien un.

>>>

while 1:

try:

nb = int(raw_input(« Entrez un nombre: « ))

print break

« Le nombre est », nb

except:

print print

« Vous n’avez pas entré un nombre ! » « Essayez encore »

Entrez

un nombre: ATCG

Vous n’avez pas entré un nombre ! Essayez encore

Entrez un nombre: toto

84

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

18 Gestion des erreurs

Vous n’avez pas entré un nombre ! Essayez encore

Entrez un nombre: 55 Le nombre est 55

Notez que dans cet exemple, l’instruction while 1 est une boucle infinie (car la condition 1 est toujours vérifiée) dont l’arrêt est forcé par la commande break lorsque l’utilisateur a effectivement bien rentré un nombre.

La gestion des erreurs est très utile dès lors que des données extérieures entrent dans le programme, que ce soit directement par l’utilisateur (avec la fonction raw_input()) ou par des fichiers.

Vous pouvez par exemple vérifier qu’un fichier a bien été ouvert.

>>>

>>>

nom = « toto.pdb » try:

f = open(nom, « r ») except:

print « Impossible d’ouvrir le fichier », nom

Si une erreur est déclenchée, c’est sans doute que le fichier n’existe pas à l’emplacement indiqué sur le disque ou que (sous Unix), vous n’ayez pas les droits d’accès pour le lire.

Il est également possible de spécifier le type d’erreur à gérer. Le premier exemple que nous avons étudié peut s’écrire :

>>>

try:

nb = int(raw_input(« Entrez un nombre: « )) except ValueError:

print « Vous n’avez pas entré un nombre ! »

Entrez un nombre: ATCG

Vous n’avez pas entré un nombre !

Ici, on intercepte une erreur de type ValueError, ce qui correspond bien à un problème de conversion avec int(). Il existe d’autres types d’erreurs comme RuntimeError, TypeError, NameError, IOError, etc.

Enfin, on peut aussi être très précis dans le message d’erreur. Observez la fonction downloadPage()

qui, avec le module urllib2, télécharge un fichier sur internet.

import urllib2

def downloadPage(address): error = «  »

page = «  » try:

data = urllib2.urlopen(address) page = data.read()

except

if

IOError, e: hasattr(e, ‘reason’):

error =

« Cannot reach web server:  » + str(e.reason)

if

hasattr(e, ‘code’):

error = « Server failed %d » %(e.code) page, error

return

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

85

18 Gestion des erreurs

La variable e est une instance (un représentant) de l’erreur de type IOError. Certains de ces attributs sont testés avec la fonction hasattr() pour ainsi affiner le message renvoyé (ici contenu dans la variable error).

86

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

19 Trucs et astuces

  1. Trucs et astuces
    1. Shebang et /usr/bin/env python

Lorsque vous programmez sur un sytème Unix, le shebang correspond aux caractères #! qui se trouve au début de la première ligne d’un script. Le shebang est suivi du chemin complet du programme qui interprète le script.

En Python, on trouve souvent la notation

#! /usr/bin/python

Cependant, l’exécutable python ne se trouve pas toujours dans le répertoire /usr/bin. Pour maximiser la portabilité de votre script Python sur plusieurs systèmes Unix, utilisez plutôt cette notation :

#! /usr/bin/env python

Dans le cas présent, on appelle le programme d’environnement env (qui se situe toujours dans le répertoire /usr/bin) pour lui demander où se trouve l’exécutable python.

19.2 Python et utf-8

Si vous utilisez des caractères accentués dans des chaînes de caractères ou bien même dans des commentaires, cela occasionnera une erreur lors de l’exécution de votre script.

Pour éviter ce genre de désagrément, ajoutez la ligne suivante à la deuxième ligne (la posi- tion est importante) de votre script :

# -*- coding: utf-8 -*-

En résumé, tous vos scripts Python devraient ainsi débuter par les lignes :

#! /usr/bin/env python # -*- coding: utf-8 -*-

19.3 Vitesse d’itération dans les boucles

La vitesse d’itération (de parcours) des élements d’une liste peut être très différente selon la structure de boucle utilisée. Pour vous en convaincre, copiez les lignes suivantes dans un script Python (par exemple boucles.py) puis exécutez-le.

#! /usr/bin/env python # -*- coding: utf-8 -*-

import time

# création d’une liste de 5 000 000 d’éléments # (à adapter suivant la vitess de vos machines) taille = 5000000

print « Création d’une liste avec %d élements » %( taille ) toto = range( taille )

# la variable ‘a’ accède à un élément de la liste

# méthode 1

start = time.time()

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

87

19 Trucs et astuces

19.4 Liste de compréhension

for i

a print

in range( len(toto) ):

= toto[i]

« méthode 1 (for in range) : %.1f secondes » %( time.time() – start )

# méthode 2

start = for ele

a =

time.time() in toto: ele

print « méthode 2 (for in) : %.1f secondes » %( time.time() – start )

# méthode 3

start for i

a print

= time.time()

in xrange( len(toto) ):

= toto[i]

« méthode 3 (for in xrange) : %.1f secondes » %( time.time() – start )

# méthode 4

start = time.time()

for idx, ele in enumerate( toto ): a = ele

print « méthode 4 (for in enumerate): %.1f secondes » %( time.time() – start

)

Vous devriez obtenir une sortie similaire à celle-ci :

poulain@cumin> Création d’une

./boucles.py

liste avec 5000000 élements in range) : 1.8 secondes in) : 1.0 secondes

in xrange) : 1.2 secondes in enumerate): 1.4 secondes

méthode méthode méthode méthode

1

2

3

4

(for (for (for (for

La méthode la plus rapide pour parcourir une liste est donc d’itérer directement sur les éléments (for element in liste). Cette instruction est à privilégier le plus possible.

La méthode for i in range(len(liste)) est particulièrement lente car la commande range(len(liste)) génère une énorme liste avec tous les indices des éléments (la création de liste est assez lente en Python). Si vous voulez absolument parcourir une liste avec les in- dices des élements, utilisez plutôt la commande for i in xrange(len(liste)) car l’ins- truction xrange() ne va pas créer une liste mais incrémenter un compteur qui correspond à l’indice des éléments successifs de la liste.

Enfin, la commande for indice, element in enumerate(liste) est particulière- ment efficace pour récupérer en même temps l’élément et son indice.

19.4 Liste de compréhension

Une manière originale et très puissante de générer des listes est la compréhension de liste.

Pour plus de détails, consultez à ce sujet le site de Python et celui de wikipédia.

Voici quelques exemples :

– Nombres pairs compris entre 0 et 99

print [i for i in range(99) if i%2 == 0]

Le même résultat est obtenu avec

print range(0,99,2)

ou

88

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

19.5

Sauvegardez votre historique de commandes

19 Trucs et astuces

print range(0,99)[::2]

Jeu sur la casse des mots d’une phrase. message = « C’est sympa la BioInfo » msg_lst = message.split()

print [[m.upper(), m.lower(), len(m)] for m in msg_lst]

Formatage d’une séquence avec 60 caractères par ligne

# exemple d’une séquence de 150 alanines seq = « A »*150

width= 60

print « \n ».join( [seq[i:i+width] for i in range(0,len(seq),width)] )

Formatage fasta d’une séquence (avec la ligne de commentaire)

commentaire = « mon commentaire »

# exemple d’une séquence de 150 alanines. seq = « A »*150

width= 60

print « > « +commentaire+ »\n »+ »\n ».join( [seq[i:i+width] for i in range(0,len(seq),width)]

)

Sélection des lignes correspondantes aux carbones alpha dans un fichier pdb

# ouverture du fichier pdb = open(« 1BTA.pdb », # sélection des lignes

pdb (par exemple 1BTA.pdb) « r »)

correspondantes aux C alpha

CA_line = [line for line in pdb if line.split()[0] == « ATOM » and line.split()[2] # fermeture du fichier

pdb.close()

# éventuellement affichage des lignes print CA_line

==

« CA »]

19.5 Sauvegardez votre historique de commandes

Vous pouvez sauvegarder l’historique des commandes utilisées dans l’interpréteur Py- thon avec le module readline.

>>> print « hello » hello

>>>

>>>

>>> 33

>>>

>>>

a = 22

a = a + 11 print a

import readline readline.write_history_file()

Quittez Python. L’historique de toutes vos commandes est dans votre répertoire person- nel, dans le fichier .history. Relancez l’interpréteur Python.

>>> import readline

>>> readline.read_history_file()

Vous pouvez accéder aux commandes de la session précédente avec la flèche du haut de votre clavier.

>>> print « hello » hello

>>>

>>>

>>> 33

a = 22

a = a + 11 print a

Cours de Python / Université Paris Diderot – Paris 7 / UFR Sciences du Vivant

Telecharger PDF